modify GSP default seq

src/bolero.nf

@@ -31,8 +31,8 @@ def helpMessage() {
     Mandatory arguments:
       --input [path]                  Path to the folder containing fast5 files. 
                                       If skip basecalling option enabled, path to fastq files folder.
-      --adapt [file]                  Path to the txt/fasta file containing the sequence of 5'RACE adapter.
-      --gsp [file]                    Path to the txt/fasta file containing the sequence of gene-specific primer used in 5'RACE amplification step.
+      --adapt [file]                  Sequence of 5'RACE adapter.
+      --gsp [file]                    Sequence of gene-specific primer used in 5'RACE amplification step.
       
     References:
       --genome [file]                 Path to the fasta file containing the genome.
@@ -83,7 +83,7 @@ if (params.help || params.h) {
 params.skipBC = true
 params.gpu_mode = false
 params.adapt = "CGACTGGAGCACGAGGACACTGACATGGACTGAAGGAGTAGAAA"
-params.gsp = "CGACTGGAGCACGAGGACACTGA" // "TTAGGCAGAGGTGAAAAAGTTG"
+params.gsp = "GTGCACACGGTCCGGCAGATG" // "TTAGGCAGAGGTGAAAAAGTTG" // "CGACTGGAGCACGAGGACACTGA"
 // params.transcriptome = "./data/202201_Full-length_HBV_GTFv3/20220112_preCore_FL_HBV_XGR_transcripts.fasta"
 params.genome = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_HBV_FL_preCore_reference.fasta"
 params.gtf = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_GTF_preCore_FL_HBV_XGR.gtf"