From 901b1a9de318b6e575e2e44a3e6394af60eb5d27 Mon Sep 17 00:00:00 2001
From: xgrand <xavier.grand@ens-lyon.fr>
Date: Tue, 21 Nov 2023 12:09:32 +0100
Subject: [PATCH] modify GSP default seq
---
src/bolero.nf | 6 +++---
1 file changed, 3 insertions(+), 3 deletions(-)
diff --git a/src/bolero.nf b/src/bolero.nf
index e11c46d..5ea7b7d 100755
--- a/src/bolero.nf
+++ b/src/bolero.nf
@@ -31,8 +31,8 @@ def helpMessage() {
Mandatory arguments:
--input [path] Path to the folder containing fast5 files.
If skip basecalling option enabled, path to fastq files folder.
- --adapt [file] Path to the txt/fasta file containing the sequence of 5'RACE adapter.
- --gsp [file] Path to the txt/fasta file containing the sequence of gene-specific primer used in 5'RACE amplification step.
+ --adapt [file] Sequence of 5'RACE adapter.
+ --gsp [file] Sequence of gene-specific primer used in 5'RACE amplification step.
References:
--genome [file] Path to the fasta file containing the genome.
@@ -83,7 +83,7 @@ if (params.help || params.h) {
params.skipBC = true
params.gpu_mode = false
params.adapt = "CGACTGGAGCACGAGGACACTGACATGGACTGAAGGAGTAGAAA"
-params.gsp = "CGACTGGAGCACGAGGACACTGA" // "TTAGGCAGAGGTGAAAAAGTTG"
+params.gsp = "GTGCACACGGTCCGGCAGATG" // "TTAGGCAGAGGTGAAAAAGTTG" // "CGACTGGAGCACGAGGACACTGA"
// params.transcriptome = "./data/202201_Full-length_HBV_GTFv3/20220112_preCore_FL_HBV_XGR_transcripts.fasta"
params.genome = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_HBV_FL_preCore_reference.fasta"
params.gtf = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_GTF_preCore_FL_HBV_XGR.gtf"
--
GitLab