Correction README.md suppress gtf option

README.md

@@ -22,10 +22,9 @@ The arguments of this pipeline are described in the table below:
 |:---------------------------:|:-------------------------------------------------------------------:| 
 | -c | configuration file. This parameter should always be `src/nextflow.config`        | 
 | -profile      | The profile to use. This can be **docker** or **singularity** to run the pipeline in docker or singularity container respectively. This can also be **psmn** to launch the analysis on the PSMN | 
-| --input [path] | Path to the folder containing fast5 files. If skip basecalling option enabled, path to fastq files folder. |
+| --input [path] | Path to the folder containing fastq files. If skip basecalling option disabled, path to fast5 files folder. |
 | --adapt [str] | Sequence of 5'RACE adapter. |
 | --genome [file] | Path to the fasta file containing the genome. HBV reference sequence preCore available in data folder. |
-| --gtf [file] | Path to the gtf file containing the genome annotation. HBV reference preCore annotation available in data folder. |
 | --skipBC [boolean] | Skip basecalling step. If truen give fastq folder as input. Default: true. |
 | --flowcell [str] | Nanopore flowcell. Default = FLO-MIN106. |
 | --kit [str] | Nanopore kit. Default = SQK-PBK004. |

src/bolero.nf

@@ -36,7 +36,6 @@ def helpMessage() {
       
     References:
       --genome [file]                 Path to the fasta file containing the genome.
-      --gtf [file]                    Path to the gtf file containing the genome annotation.
 
     Nanopore basecalling:
       --skipBC [boolean]              Skip basecalling step. If true, give fastq folder as input. Default: true.
@@ -87,7 +86,7 @@ params.gsp = "GTGCACACGGTCCGGCAGATG" // "TTAGGCAGAGGTGAAAAAGTTG" // "CGACTGGAGCA
 //params.5p_seq = "ACATGGACTGAAGGAGTAGAAA"
 //params.3p_seq = "GGACTCCCCGTCTGTGCCTTCT"
 params.genome = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_HBV_FL_preCore_reference.fasta"
-params.gtf = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_GTF_preCore_FL_HBV_XGR.gtf"
+//params.gtf = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_GTF_preCore_FL_HBV_XGR.gtf"
 
 params.flowcell = "FLO-MIN106"
 params.kit = "SQK-PBK004"
@@ -144,10 +143,12 @@ Channel
     .ifEmpty { error "No genome defined, a fasta file containing the full length preC RNA from HBV genome." }
     .set { genome }
 
+/*
 Channel
     .fromPath( params.gtf )
     .ifEmpty { error "No annotation defined, a gtf file describing transcripts and splice variants." }
     .set { gtf }
+*/
 
 Channel
     .fromPath(params.input+'*/', type: 'dir')