From 7bd3beebb4cefeb4dfac569d890ae7c4bdcee4e7 Mon Sep 17 00:00:00 2001
From: xgrand <xavier.grand@ens-lyon.fr>
Date: Thu, 12 Sep 2024 10:30:34 +0200
Subject: [PATCH] Correction README.md suppress gtf option
---
README.md | 3 +--
src/bolero.nf | 5 +++--
2 files changed, 4 insertions(+), 4 deletions(-)
diff --git a/README.md b/README.md
index 5fb398d..8282b89 100755
--- a/README.md
+++ b/README.md
@@ -22,10 +22,9 @@ The arguments of this pipeline are described in the table below:
|:---------------------------:|:-------------------------------------------------------------------:|
| -c | configuration file. This parameter should always be `src/nextflow.config` |
| -profile | The profile to use. This can be **docker** or **singularity** to run the pipeline in docker or singularity container respectively. This can also be **psmn** to launch the analysis on the PSMN |
-| --input [path] | Path to the folder containing fast5 files. If skip basecalling option enabled, path to fastq files folder. |
+| --input [path] | Path to the folder containing fastq files. If skip basecalling option disabled, path to fast5 files folder. |
| --adapt [str] | Sequence of 5'RACE adapter. |
| --genome [file] | Path to the fasta file containing the genome. HBV reference sequence preCore available in data folder. |
-| --gtf [file] | Path to the gtf file containing the genome annotation. HBV reference preCore annotation available in data folder. |
| --skipBC [boolean] | Skip basecalling step. If truen give fastq folder as input. Default: true. |
| --flowcell [str] | Nanopore flowcell. Default = FLO-MIN106. |
| --kit [str] | Nanopore kit. Default = SQK-PBK004. |
diff --git a/src/bolero.nf b/src/bolero.nf
index 918bdbb..a311cb2 100755
--- a/src/bolero.nf
+++ b/src/bolero.nf
@@ -36,7 +36,6 @@ def helpMessage() {
References:
--genome [file] Path to the fasta file containing the genome.
- --gtf [file] Path to the gtf file containing the genome annotation.
Nanopore basecalling:
--skipBC [boolean] Skip basecalling step. If true, give fastq folder as input. Default: true.
@@ -87,7 +86,7 @@ params.gsp = "GTGCACACGGTCCGGCAGATG" // "TTAGGCAGAGGTGAAAAAGTTG" // "CGACTGGAGCA
//params.5p_seq = "ACATGGACTGAAGGAGTAGAAA"
//params.3p_seq = "GGACTCCCCGTCTGTGCCTTCT"
params.genome = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_HBV_FL_preCore_reference.fasta"
-params.gtf = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_GTF_preCore_FL_HBV_XGR.gtf"
+//params.gtf = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_GTF_preCore_FL_HBV_XGR.gtf"
params.flowcell = "FLO-MIN106"
params.kit = "SQK-PBK004"
@@ -144,10 +143,12 @@ Channel
.ifEmpty { error "No genome defined, a fasta file containing the full length preC RNA from HBV genome." }
.set { genome }
+/*
Channel
.fromPath( params.gtf )
.ifEmpty { error "No annotation defined, a gtf file describing transcripts and splice variants." }
.set { gtf }
+*/
Channel
.fromPath(params.input+'*/', type: 'dir')
--
GitLab