Skip to content
Snippets Groups Projects
Commit eccb6d43 authored by nfontrod's avatar nfontrod
Browse files

tests/files/test_genome.fa: a fasta file used for test

parent c5f95e9e
No related branches found
No related tags found
No related merge requests found
Hide whitespace changes
Inline Side-by-side
tests/files/test_genome.fa 0 → 100644
+ 2
− 0
View file @ eccb6d43
>chr1
CGCGCGCGCGGAGAGAGAGAATATATATAT
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment