Skip to content
Snippets Groups Projects
Commit 3c49e456 authored by elabaron's avatar elabaron
Browse files

add template for Riboseq

parent 5c3c7851
No related branches found
No related tags found
No related merge requests found
......@@ -2,6 +2,7 @@
set -e
# For RNASeq
nextflow src/RNAseq.nf -c src/RNAseq.config \
-profile docker\
-resume\
......@@ -11,8 +12,25 @@ nextflow src/RNAseq.nf -c src/RNAseq.config \
--adaptorR1 "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"\
--adaptorR2 "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"\
--strand "FR"\
--fastq_raw "data/fastq/*HIV1*{_R1,_R2}_short.fastq.gz"\
--output "results_tophatVShisat/tophat"\
--fastq_raw "data/fastq/*{_R1,_R2}_short.fastq.gz"\
--output "results"\
--filter "data/filter/*.bt2"\
--index_genome "data/genome/*.ht2"\
--gtf "data/annotation/gencode.v28.annotation_v3.gtf"\
--gtf_collapse "data/annotation/gencode.v28.annotation_v3_collapse.gtf"\
--index_postgenome "data/post_genome/*.ht2"
# For Ribosome Profiling
nextflow src/RibosomeProfiling.nf -c src/RNAseq.config \
-profile docker\
-resume\
--do_fastqc true\
--do_dedup false\
--do_postgenome true\
--adaptorR1 "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"\
--strand "F"\
--fastq_raw "data/fastq/*.fastq.gz"\
--output "results"\
--filter "data/filter/*.bt2"\
--index_genome "data/genome/*.ht2"\
--gtf "data/annotation/gencode.v28.annotation_v3.gtf"\
......
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Please register or to comment