src/nf_modules/bowtie/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "1.2.2"
+container_url = "lbmc/bowtie:${version}"
+
+params.index_fasta = ""
+params.index_fasta_out = ""
+process index_fasta {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.index_fasta_out != "") {
+    publishDir "results/${params.index_fasta_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(fasta)
+
+  output:
+    tuple val(file_id), path("*.index*"), emit: index
+    tuple val(file_id), path("*_report.txt"), emit: report
+
+  script:
+"""
+bowtie-build --threads ${task.cpus} \
+  ${params.index_fasta} \
+  -f ${fasta} ${fasta.baseName}.index &> \
+  ${fasta.baseName}_bowtie_index_report.txt
+
+if grep -q "Error" ${fasta.baseName}_bowtie_index_report.txt; then
+  exit 1
+fi
+"""
+}
+
+params.mapping_fastq = "--very-sensitive"
+params.mapping_fastq_out = ""
+process mapping_fastq {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$pair_id"
+  if (params.mapping_fastq_out != "") {
+    publishDir "results/${params.mapping_fastq_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(index_id), path(index)
+  tuple val(file_id), path(reads)
+
+  output:
+  tuple val(file_id), path("*.bam"), emit: bam
+  path "*_report.txt", emit: report
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+  index_id = index[0]
+  for (index_file in index) {
+    if (index_file =~ /.*\.1\.bt2/ && !(index_file =~ /.*\.rev\.1\.bt2/)) {
+        index_id = ( index_file =~ /(.*)\.1\.bt2/)[0][1]
+    }
+  }
+  if (reads.size() == 2)
+  """
+  # -v specify the max number of missmatch, -k the number of match reported per
+  # reads
+  bowtie --best -v 3 -k 1 --sam -p ${task.cpus} ${index_id} \
+    ${params.mapping_fastq} \
+    -1 ${reads[0]} -2 ${reads[1]} 2> \
+    ${file_id}_bowtie_report_tmp.txt | \
+    samtools view -Sb - > ${file_id}.bam
+
+  if grep -q "Error" ${file_id}_bowtie_report_tmp.txt; then
+    exit 1
+  fi
+  tail -n 19 ${file_id}_bowtie_report_tmp.txt > \
+    ${file_id}_bowtie_mapping_report.txt
+  """
+  else
+  """
+  bowtie --best -v 3 -k 1 --sam -p ${task.cpus} ${index_id} \
+    ${params.mapping_fastq}
+    -q ${reads} 2> \
+    ${file_id}_bowtie_report_tmp.txt | \
+    samtools view -Sb - > ${file_id}.bam
+
+  if grep -q "Error" ${file_id}_bowtie_report_tmp.txt; then
+    exit 1
+  fi
+  tail -n 19 ${file_id}_bowtie_report_tmp.txt > \
+    ${file_id}_bowtie_mapping_report.txt
+  """
+}
+
+params.mapping_fastq_pairedend = ""
+process mapping_fastq_pairedend {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$pair_id"
+
+  input:
+  path index
+  tuple val(pair_id), path(reads)
+
+  output:
+  tuple val(pair_id), path("*.bam"), emit: bam
+  path "*_report.txt", emit: report
+
+  script:
+  index_id = index[0]
+  for (index_file in index) {
+    if (index_file =~ /.*\.1\.bt2/ && !(index_file =~ /.*\.rev\.1\.bt2/)) {
+        index_id = ( index_file =~ /(.*)\.1\.bt2/)[0][1]
+    }
+  }
+"""
+# -v specify the max number of missmatch, -k the number of match reported per
+# reads
+bowtie --best -v 3 -k 1 --sam -p ${task.cpus} ${index_id} \
+  ${params.mapping_fastq_pairedend} \
+  -1 ${reads[0]} -2 ${reads[1]} 2> \
+  ${pair_id}_bowtie_report_tmp.txt | \
+  samtools view -Sb - > ${pair_id}.bam
+
+if grep -q "Error" ${pair_id}_bowtie_report_tmp.txt; then
+  exit 1
+fi
+tail -n 19 ${pair_id}_bowtie_report_tmp.txt > \
+  ${pair_id}_bowtie_mapping_report.txt
+"""
+}
+
+params.mapping_fastq_singleend = ""
+process mapping_fastq_singleend {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+
+  input:
+  path index
+  tuple val(file_id), path(reads)
+
+  output:
+  set file_id, "*.bam", emit: bam
+  file "*_report.txt", emit: report
+
+  script:
+  index_id = index[0]
+  for (index_file in index) {
+    if (index_file =~ /.*\.1\.bt2/ && !(index_file =~ /.*\.rev\.1\.bt2/)) {
+        index_id = ( index_file =~ /(.*)\.1\.bt2/)[0][1]
+    }
+  }
+"""
+bowtie --best -v 3 -k 1 --sam -p ${task.cpus} ${index_id} \
+  ${params.mapping_fastq_singleend} \
+  -q ${reads} 2> \
+  ${file_id}_bowtie_report_tmp.txt | \
+  samtools view -Sb - > ${file_id}.bam
+
+if grep -q "Error" ${file_id}_bowtie_report_tmp.txt; then
+  exit 1
+fi
+tail -n 19 ${file_id}_bowtie_report_tmp.txt > \
+  ${file_id}_bowtie_mapping_report.txt
+"""
+}

src/nf_modules/bowtie2/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "2.3.4.1"
+container_url = "lbmc/bowtie2:${version}"
+
+params.index_fasta = ""
+params.index_fasta_out = ""
+process index_fasta {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.index_fasta_out != "") {
+    publishDir "results/${params.index_fasta_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(fasta)
+
+  output:
+    tuple val(file_id), path("*.bt2"), emit: index
+    tuple val(file_id), path("*_report.txt"), emit: report
+
+  script:
+"""
+bowtie2-build --threads ${task.cpus} \
+  ${fasta} \
+  ${fasta.simpleName} &> \
+  ${fasta.simpleName}_bowtie2_index_report.txt
+
+if grep -q "Error" ${fasta.simpleName}_bowtie2_index_report.txt; then
+  exit 1
+fi
+"""
+}
+
+params.mapping_fastq = "--very-sensitive"
+params.mapping_fastq_out = ""
+process mapping_fastq {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.mapping_fastq_out != "") {
+    publishDir "results/${params.mapping_fastq_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(index_id), path(index)
+  tuple val(file_id), path(reads)
+
+  output:
+  tuple val(file_id), path("*.bam"), emit: bam
+  path "*_report.txt", emit: report
+
+  script:
+  index_id = index[0]
+  for (index_file in index) {
+    if (index_file =~ /.*\.1\.bt2/ && !(index_file =~ /.*\.rev\.1\.bt2/)) {
+        index_id = ( index_file =~ /(.*)\.1\.bt2/)[0][1]
+    }
+  }
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  if (reads.size() == 2)
+  """
+  bowtie2 ${params.mapping_fastq} \
+    -p ${task.cpus} \
+    -x ${index_id} \
+    -1 ${reads[0]} \
+    -2 ${reads[1]} 2> \
+    ${file_prefix}_bowtie2_mapping_report_tmp.txt | \
+    samtools view -Sb - > ${file_prefix}.bam
+
+  if grep -q "Error" ${file_prefix}_bowtie2_mapping_report_tmp.txt; then
+    exit 1
+  fi
+  tail -n 19 ${file_prefix}_bowtie2_mapping_report_tmp.txt > \
+    ${file_prefix}_bowtie2_mapping_report.txt
+  """
+  else
+  """
+  bowtie2 ${params.mapping_fastq} \
+    -p ${task.cpus} \
+    -x ${index_id} \
+    -U ${reads} 2> \
+    ${file_prefix}_bowtie2_mapping_report_tmp.txt | \
+    samtools view -Sb - > ${file_prefix}.bam
+
+  if grep -q "Error" ${file_prefix}_bowtie2_mapping_report_tmp.txt; then
+    exit 1
+  fi
+  tail -n 19 ${file_prefix}_bowtie2_mapping_report_tmp.txt > \
+    ${file_prefix}_bowtie2_mapping_report.txt
+  """
+}

src/nf_modules/bwa/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.7.17"
+container_url = "lbmc/bwa:${version}"
+
+
+workflow mapping {
+  take:
+    fasta
+    fastq
+  main:
+    index_fasta(fasta)
+    mapping_fastq(index_fasta.out.index.collect(), fastq)
+  emit:
+    bam = mapping_fastq.out.bam
+    report = mapping_fastq.out.report
+}
+
+
+params.index_fasta = ""
+params.index_fasta_out = ""
+process index_fasta {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.index_fasta_out != "") {
+    publishDir "results/${params.index_fasta_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(fasta)
+
+  output:
+    tuple val(file_id), path("${fasta.simpleName}.*"), emit: index
+    tuple val(file_id), path("*_bwa_report.txt"), emit: report
+
+  script:
+"""
+bwa index ${params.index_fasta} -p ${fasta.simpleName} ${fasta} \
+&> ${fasta.simpleName}_bwa_report.txt
+"""
+}
+
+
+params.mapping_fastq = ""
+params.mapping_fastq_out = ""
+process mapping_fastq {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.mapping_fastq_out != "") {
+    publishDir "results/${params.mapping_fastq_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(index_id), path(index)
+  tuple val(file_id), path(reads)
+
+  output:
+  tuple val(file_id), path("*.bam"), emit: bam
+  tuple val(file_id), path("${file_prefix}_bwa_report.txt"), emit: report
+
+  script:
+  if (file_id instanceof List){
+    library = file_id[0]
+    file_prefix = file_id[0]
+  } else if (file_id instanceof Map) {
+      library = file_id[0]
+      file_prefix = file_id[0]
+      if (file_id.containsKey('library')) {
+        library = file_id.library
+        file_prefix = file_id.id
+      }
+  } else {
+    library = file_id
+    file_prefix = file_id
+  }
+bwa_mem_R = "@RG\\tID:${library}\\tSM:${library}\\tLB:lib_${library}\\tPL:illumina"
+  if (reads.size() == 2)
+"""
+bwa mem -t ${task.cpus} \
+${params.mapping_fastq} \
+-R '${bwa_mem_R}' \
+${index[0].baseName} ${reads[0]} ${reads[1]} 2> \
+  ${file_prefix}_bwa_report.txt | \
+  samtools view -@ ${task.cpus} -Sb - > ${file_prefix}.bam
+"""
+  else
+"""
+bwa mem -t ${task.cpus} \
+${params.mapping_fastq} \
+-R '${bwa_mem_R}' \
+${index[0].baseName} ${reads} 2> \
+  ${file_prefix}_bwa_report.txt | \
+  samtools view -@ ${task.cpus} -Sb - > ${file_prefix}.bam
+"""
+}
+

src/nf_modules/cellphonedb/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "3.0.0"
+container_url = "mlepetit/cellphonedb:latest"
+
+params.cellphonedb = ""
+params.cellphonedb_out = ""
+params.pval=""
+params.thres=""
+params.iterations=""
+params.gene_id=""
+
+
+
+workflow cellphone_statistical_analysis {
+  take:
+    meta
+    counts
+
+  main:
+
+cpdb_methods_stats(meta,counts)
+cpdb_plot_dot_plot(cpdb_methods_stats.out.means,cpdb_methods_stats.out.pvalues)
+cpdb_plot_heatmap(cpdb_methods_stats.out.pvalues)
+
+
+  emit:
+    means = cpdb_methods_stats.out.means
+    pvalues = cpdb_methods_stats.out.pvalues
+    deconvoluted = cpdb_methods_stats.out.deconvoluted
+    significant_means = cpdb_methods_stats.out.significant_means
+    dot_plot = cpdb_plot_dot_plot.out.dot_plot
+    heatmap = cpdb_plot_heatmap.out.heatmap
+    heatmap_log = cpdb_plot_heatmap.out.heatmap_log
+    count_network = cpdb_plot_heatmap.out.count_network
+    interactions_count = cpdb_plot_heatmap.out.interactions_count
+
+
+}
+
+
+
+
+
+
+
+
+
+
+process cpdb_methods_stats {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+    if (params.cellphonedb_out != "") {
+    publishDir "results/${params.cellphonedb_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(id_mtx), path(meta)
+    tuple val(id_mtx), path(counts)
+  
+  output:
+   tuple val(id_mtx), path("out/means.txt"), emit: means
+   tuple val(id_mtx), path("out/pvalues.txt"), emit: pvalues
+   tuple val(id_mtx), path("out/deconvoluted.txt"), emit: deconvoluted
+   tuple val(id_mtx), path("out/significant_means.txt"), emit: significant_means
+  
+script:
+  """
+cellphonedb method statistical_analysis ${params.meta} ${params.counts} --counts-data ${params.gene_id}  --threads ${task.cpus} --iterations ${params.iterations} --pvalue ${params.pval} --threshold ${params.thres}
+
+  """
+}
+
+
+process cpdb_plot_dot_plot {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+    if (params.cellphonedb_out != "") {
+    publishDir "results/${params.cellphonedb_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(id_mtx), path(means)
+    tuple val(id_mtx), path(pvalues)
+
+  output:
+   tuple val(id_mtx), path("out/plot.pdf"), emit: dot_plot
+
+script:
+  """
+mkdir ./out
+cellphonedb plot dot_plot --means-path ${means} --pvalues-path ${pvalues} 
+
+  """
+}
+ 
+process cpdb_plot_heatmap {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+    if (params.cellphonedb_out != "") {
+    publishDir "results/${params.cellphonedb_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(id_mtx), path(pvalues)
+
+  output:
+   tuple val(id_mtx), path("out/heatmap_count.pdf"), emit: heatmap
+ tuple val(id_mtx), path("out/heatmap_log_count.pdf"), emit: heatmap_log
+ tuple val(id_mtx), path("out/count_network.txt"), emit: count_network
+ tuple val(id_mtx), path("out/interaction_count.txt"), emit: interactions_count
+
+script:
+ 
+ """
+mkdir ./out
+cellphonedb plot heatmap_plot --pvalues-path ${pvalues} --pvalue ${params.pval} ${params.meta}
+
+  """
+}

src/nf_modules/cutadapt/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "2.1"
+container_url = "lbmc/cutadapt:${version}"
+
+params.adapter_3_prim = "AGATCGGAAGAG"
+params.adapter_5_prim = "CTCTTCCGATCT"
+params.adaptor_removal = "-a ${params.adapter_3_prim} -g ${params.adapter_5_prim} -A ${params.adapter_3_prim} -G ${params.adapter_5_prim}"
+params.adaptor_removal_out = ""
+process adaptor_removal {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.adaptor_removal_out != "") {
+    publishDir "results/${params.adaptor_removal_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(reads)
+
+  output:
+  tuple val(file_id), path("*_cut_*"), emit: fastq
+  path "*_report.txt", emit: report
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+  if (reads.size() == 2)
+  """
+  cutadapt ${params.adaptor_removal} \
+  -o ${file_prefix}_cut_R1.fastq.gz -p ${file_prefix}_cut_R2.fastq.gz \
+  ${reads[0]} ${reads[1]} > ${file_prefix}_report.txt
+  """
+  else
+  """
+  cutadapt ${params.adaptor_removal} \
+  -o ${file_prefix}_cut.fastq.gz \
+  ${reads} > ${file_prefix}_report.txt
+  """
+}
+
+params.trim_quality = "20"
+params.trimming = "-q ${params.trim_quality},${params.trim_quality}"
+params.trimming_out = ""
+process trimming {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.trimming_out != "") {
+    publishDir "results/${params.trimming_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(reads)
+
+  output:
+  tuple val(file_id), path("*_trim_*"), emit:fastq
+  path "*_report.txt", emit: report
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+  if (reads.size() == 2)
+  """
+  cutadapt ${params.trimming} \
+  -o ${file_prefix}_trim_R1.fastq.gz -p ${file_prefix}_trim_R2.fastq.gz \
+  ${reads[0]} ${reads[1]} > ${file_prefix}_report.txt
+  """
+  else
+  """
+  cutadapt ${params.trimming} \
+  -o ${file_prefix}_trim.fastq.gz \
+  ${reads} > ${file_prefix}_report.txt
+  """
+}
+
+
+process 5pRACE {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"tag "$file_id"
+  
+  if (params.cutadapt_out != "") {
+    publishDir "results/${params.cutadapt_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(fastq)
+
+  output:
+  tuple val(file_id), path("*_cut_*"), emit: fastq
+
+  """
+  cutadapt -e 0.2 -g CGACTGGAGCACGAGGACACTGACATGGACTGAAGGAGTAGAAA -g TTAGGCAGAGGTGAAAAAGTTG 
+                  -a TTTCTACTCCTTCAGTCCATGTCAGTGTCCTCGTGCTCCAGTCG -a CAACTTTTTCACCTCTGCCTAA 
+                  -o ${}
+                  ${fastq}
+  """
+}
\ No newline at end of file

src/nf_modules/danpos/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "v2.2.2_cv3"
+container_url = "biocontainers/danpos:${version}"
+
+include {
+  bigwig2_to_wig2;
+  bigwig_to_wig;
+  wig_to_bedgraph;
+  wig2_to_bedgraph2
+} from "./../ucsc/main.nf"
+
+params.dpos = "--smooth_width 0 -n N "
+params.dpos_out = ""
+
+workflow dpos_bam_bg {
+  take:
+    fasta
+    fastq
+    bam
+
+  main:
+    dpos_bam(fastq, bam)
+    wig2_to_bedgraph2(fasta, dpos_bam.out.wig)
+
+  emit:
+    bg = wig2_to_bedgraph2.out.bg
+    wig = dpos_bam.out.wig
+    bed = dpos_bam.out.bed
+}
+
+process dpos_bam {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(bam_ip), path(bam_wce)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/${bam_ip.simpleName}*.wig"), path("${file_prefix}/${bam_wce.simpleName}*.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -b ${bam_wce} \
+  -o ${file_prefix} \
+  ${bam_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.bed
+"""
+}
+
+workflow dpos_bw {
+  take:
+    fasta
+    fastq
+    bw
+  main:
+    bigwig2_to_wig2(bw)
+    dpos_wig(fastq, bigwig2_to_wig2.out.wig)
+    wig_to_bedgraph(fasta, bigwig2_to_wig2.out.wig)
+
+  emit:
+  bg = wig_to_bedgraph.out.bg
+  wig = bigwig2_to_wig2.out.wig
+  bed = dpos_wig.out.bed
+}
+
+process dpos_wig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(wig_ip), path(wig_wce)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+    tuple val(file_id), path("${file_prefix}/${bam_ip.simpleName}*.wig"), path("${file_prefix}/${bam_wce.simpleName}*.wig"), emit: wig
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -b ${wig_wce} \
+  -o ${file_prefix} \
+  ${wig_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.positions.xls > ${file_prefix}/${wig_ip.simpleName}.positions.bed
+"""
+}
+
+workflow dpos_bw_no_b {
+  take:
+    fasta
+    fastq
+    bw
+  main:
+    bigwig_to_wig(bw)
+    dpos_wig_no_b(fastq, bigwig_to_wig.out.wig)
+    wig_to_bedgraph(fasta, bigwig_to_wig.out.wig)
+
+  emit:
+  bg = wig_to_bedgraph.out.bg
+  wig = bigwig_to_wig.out.wig
+  bed = dpos_wig_no_b.out.bed
+}
+
+process dpos_wig_no_b {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(wig_ip)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -o ${file_prefix} \
+  ${wig_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.positions.xls > ${file_prefix}/${wig_ip.simpleName}.positions.bed
+"""
+}
+
+workflow dwig_bwvsbw {
+  take:
+    fasta
+    fastq
+    bw_a
+    bw_b
+  main:
+    dpos_wigvswig(
+      fastq,
+      bigwig2_to_wig2(bw_a),
+      bigwig2_to_wig2(bw_b),
+    )
+    wig_to_bedgraph(fasta, dpos_wigvswig.out.wig)
+
+  emit:
+  bg = wig_to_bedgraph.out.bg
+  wig = dpeak_wig.out.wig
+  bed = dpeak_wig.out.bed
+}
+
+process dpos_wigvswig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id_a), path(wig_ip_a)
+    tuple val(file_id_b), path(wig_ip_b)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/${wig_ip_a.simpleName}*.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+
+  script:
+
+  switch(file_id_a) {
+    case {it instanceof List}:
+      file_prefix = file_id_a[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id_a.values()[0]
+    break
+    default:
+      file_prefix = file_id_a
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -b ${wig_ip_a},${wig_ip_b} \
+  -o ${file_prefix} \
+  ${wig_ip_a}:${wig_ip_b}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.positions.xls > ${file_prefix}/${bam_ip.simpleName}.positions.bed
+"""
+}
+
+params.dpeak = "--smooth_width 0 -n N "
+params.dpeak_out = ""
+
+process dpeak_bam {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpeak_out != "") {
+    publishDir "results/${params.dpeak_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(bam_ip), path(bam_wce)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/${bam_ip.simpleName}*.wig"), path("${file_prefix}/${bam_wce.simpleName}*.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), path("${file_prefix}/*.summit.bed"), emit: bed
+    tuple val(file_id), path("${file_prefix}/*.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpeak -m ${m} \
+  ${params.dpeak} \
+  -b ${bam_wce} \
+  -o ${file_prefix} \
+  ${bam_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.bed
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$4-1, \$4, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.summit.bed
+"""
+}
+
+workflow dpeak_bw {
+  take:
+    fasta
+    fastq
+    bw
+  main:
+    dpeak_wig(fastq, bigwig2_to_wig2(bw))
+    wig2_to_bedgraph2(fasta, dpeak_wig.out.wig)
+
+  emit:
+  bg = wig2_to_bedgraph2.out.bg
+  wig = dpeak_wig.out.wig
+  bed = dpeak_wig.out.bed
+}
+
+
+process dpeak_wig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpeak_out != "") {
+    publishDir "results/${params.dpeak_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(wig_ip), path(wig_wce)
+
+  output:
+  tuple val(file_id), path("${file_prefix}/${wig_ip.simpleName}.bgsub.wig"), path("${file_prefix}/${wig_wce.simpleName}.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), path("${file_prefix}/*.summit.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpeak -m ${m} \
+  ${params.dpeak} \
+  -b ${wig_wce} \
+  -o ${file_prefix} \
+  ${wig_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${wig_ip.simpleName}.bgsub.positions.bed
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$4-1, \$4, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${wig_ip.simpleName}.bgsub.positions.summit.bed
+"""
+}
+
+workflow dpeak_bwvsbw {
+  take:
+    fasta
+    fastq
+    bw_a
+    bw_b
+  main:
+    dpeak_wigvswig(
+      fastq,
+      bigwig2_to_wig2(bw_a),
+      bigwig2_to_wig2(bw_b),
+    )
+    wig2_to_bedgraph2(fasta, dpeak_wigvswig.out.wig)
+
+  emit:
+  bg = wig2_to_bedgraph2.out.bg
+  wig = dpeak_wig.out.wig
+  bed = dpeak_wig.out.bed
+}
+
+
+process dpeak_wigvswig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpeak_out != "") {
+    publishDir "results/${params.dpeak_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id_a), path(wig_ip_a), path(wig_wce_a)
+    tuple val(file_id_b), path(wig_ip_b), path(wig_wce_b)
+
+  output:
+  tuple val(file_id), path("${file_prefix}/${wig_ip_a.simpleName}.bgsub.wig"), path("${file_prefix}/${wig_wce_a.simpleName}.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), path("${file_prefix}/*.summit.bed"), emit: bed
+
+  script:
+
+  switch(file_id_a) {
+    case {it instanceof List}:
+      file_prefix = file_id_a[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id_a.values()[0]
+    break
+    default:
+      file_prefix = file_id_a
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpeak -m ${m} \
+  ${params.dpeak} \
+  -b ${wig_ip_a}:${wig_wce_a},${wig_ip_b}:${wig_wce_b} \
+  -o ${file_prefix} \
+  ${wig_ip_a}:${wig_ip_b}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.bed
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$4-1, \$4, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.summit.bed
+"""
+}
\ No newline at end of file

src/nf_modules/deeptools/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "3.5.1"
+container_url = "lbmc/deeptools:${version}"
+
+params.index_bam = ""
+params.index_bam_out = ""
+process index_bam {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.index_bam_out != "") {
+    publishDir "results/${params.index_bam_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(bam)
+
+  output:
+    tuple val(file_id), path("${bam}"), path("*.bam*"), emit: bam_idx
+
+  script:
+"""
+sambamba index -t ${task.cpus} ${bam}
+"""
+}
+
+params.bam_to_bigwig = ""
+params.bam_to_bigwig_out = ""
+process bam_to_bigwig {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.bam_to_bigwig_out != "") {
+    publishDir "results/${params.bam_to_bigwig_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(bam), path(idx)
+
+  output:
+    tuple val(file_id), path("*.bw"), emit: bw
+
+  script:
+"""
+bamCoverage -p ${task.cpus} --ignoreDuplicates -b ${bam} \
+  -o ${bam.simpleName}.bw
+"""
+}
+
+params.compute_matrix = ""
+params.compute_matrix_out = ""
+process compute_matrix {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "${bed_file_id}"
+  if (params.compute_matrix_out != "") {
+    publishDir "results/${params.compute_matrix_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(bw)
+    tuple val(bed_file_id), path(bed)
+
+  output:
+    tuple val(bed_file_id), path("*.mat.gz"), emit: matrix
+
+  script:
+"""
+computeMatrix scale-regions -S ${bw} \
+  -p ${task.cpus} \
+  -R ${bed} \
+  --beforeRegionStartLength 100 \
+  --afterRegionStartLength 100 \
+  -o ${bed.simpleName}.mat.gz
+"""
+}
+
+params.plot_profile = ""
+params.plot_profile_out = ""
+process plot_profile {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.compute_matrix_out != "") {
+    publishDir "results/${params.compute_matrix_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(matrix)
+
+  output:
+    tuple val(file_id), path("*.pdf"), emit: pdf
+
+  script:
+/*
+see more option at
+https://deeptools.readthedocs.io/en/develop/content/tools/plotProfile.html
+*/
+"""
+plotProfile -m ${matrix} \
+  --plotFileFormat=pdf \
+  -out ${matrix.simpleName}.pdf \
+  --plotType=fill \
+  --perGroup \
+  --plotTitle "${params.title}"
+"""
+}

src/nf_modules/emase-zero/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.3.1"
+container_url = "lbmc/emase-zero:${version}"
+
+include { g2tr } from "./../kb/main.nf"
+include { bam2ec } from "./../alntools/main.nf"
+include { fasta_to_transcripts_lengths } from "./../bioawk/main.nf"
+
+
+params.count = "-m 2"
+params.count_out = ""
+workflow count {
+  take:
+    bam_idx
+    fasta
+    gtf
+
+  main:
+    g2tr(gtf)
+    fasta_to_transcripts_lengths(fasta)
+    bam2ec(bam_idx, fasta_to_transcripts_lengths.out.tsv.collect())
+    emase(bam2ec.out.bin, fasta.collect(), bam2ec.out.tsv, g2tr.out.g2t.collect())
+
+  emit:
+    count = emase.out.count
+}
+
+process emase {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.count_out != "") {
+    publishDir "results/${params.count_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(bin)
+    tuple val(fasta_id), path(fasta)
+    tuple val(transcript_length_id), path(transcript_length)
+    tuple val(gene_to_transcript_id), path(gene_to_transcript)
+
+  output:
+    tuple val(file_id), path("${bin.simpleName}.quantified*"), emit: count
+    path "*_report.txt", emit: report
+
+  script:
+"""
+grep ">" ${fasta} | sed 's/>//' > tr_list.txt
+emase-zero ${params.count} \
+  -o ${bin.simpleName}.quantified \
+  -l ${transcript_length} \
+  -g ${gene_to_transcript} \
+  ${bin} &> ${file_id}_emase-zero_report.txt
+"""
+}
\ No newline at end of file

src/nf_modules/emase/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.10.16"
+container_url = "lbmc/emase:${version}"
+
+params.diploid_genome = "-x"
+params.diploid_genome_out = "-x"
+process diploid_genome {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "${genome_a}-${genome_b}"
+  if (params.diploid_genome_out != "") {
+    publishDir "results/${params.diploid_genome_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(genome_a), path(fasta_a), val(genome_b), path(fasta_b)
+
+  output:
+    tuple val("${genome_a}_${genome_b}"), path(".fa"), emit: fasta
+
+  script:
+"""
+prepare-emase -G ${fasta_a},${fasta_b} -s ${genome_a},${genome_b} ${params.diploid_genome} 
+"""
+}
\ No newline at end of file

src/nf_modules/fastp/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.23.2"
+container_url = "lbmc/fastp:${version}"
+
+params.fastp_protocol = ""
+
+params.fastp = ""
+params.fastp_out = ""
+workflow fastp {
+  take:
+    fastq
+
+  main:
+  switch(params.fastp_protocol) {
+    case "accel_1splus":
+      fastp_accel_1splus(fastq)
+      fastp_accel_1splus.out.fastq.set{res_fastq}
+      fastp_accel_1splus.out.report.set{res_report}
+    break;
+    default:
+      fastp_default(fastq)
+      fastp_default.out.fastq.set{res_fastq}
+      fastp_default.out.report.set{res_report}
+    break;
+  }
+  emit:
+    fastq = res_fastq
+    report = res_report
+}
+
+process fastp_default {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_prefix"
+  if (params.fastp_out != "") {
+    publishDir "results/${params.fastp_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(reads)
+
+  output:
+    tuple val(file_id), path("*_trim.fastq.gz"), emit: fastq
+    tuple val(file_id), path("${file_prefix}.html"), emit: html
+    tuple val(file_id), path("${file_prefix}_fastp.json"), emit: report
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+  if (reads.size() == 2)
+  """
+  fastp --thread ${task.cpus} \
+    --qualified_quality_phred 20 \
+    --disable_length_filtering \
+    --detect_adapter_for_pe \
+    ${params.fastp} \
+    --in1 ${reads[0]} \
+    --in2 ${reads[1]} \
+    --out1 ${file_prefix}_R1_trim.fastq.gz \
+    --out2 ${file_prefix}_R2_trim.fastq.gz \
+    --html ${file_prefix}.html \
+    --json ${file_prefix}_fastp.json \
+    --report_title ${file_prefix}
+  """
+  else
+  """
+  fastp --thread ${task.cpus} \
+    --qualified_quality_phred 20 \
+    --disable_length_filtering \
+    --detect_adapter_for_pe \
+    ${params.fastp} \
+    --in1 ${reads[0]} \
+    --out1 ${file_prefix}_trim.fastq.gz \
+    --html ${file_prefix}.html \
+    --json ${file_prefix}_fastp.json \
+    --report_title ${file_prefix}
+  """
+}
+
+process fastp_accel_1splus {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_prefix"
+  if (params.fastp_out != "") {
+    publishDir "results/${params.fastp_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(reads)
+
+  output:
+    tuple val(file_id), path("*_trim.fastq.gz"), emit: fastq
+    tuple val(file_id), path("${file_prefix}.html"), emit: html
+    tuple val(file_id), path("${file_prefix}_fastp.json"), emit: report
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+
+  if (reads.size() == 2)
+  """
+  fastp --thread ${task.cpus} \
+    --disable_quality_filtering \
+    --disable_length_filtering \
+    --disable_trim_poly_g \
+    --detect_adapter_for_pe \
+    --stdout \
+    --in1 ${reads[0]} \
+    --in2 ${reads[1]} 2> /dev/null | \
+    fastp --thread ${task.cpus} \
+      --stdin \
+      --interleaved_in \
+      --trim_front1=10 \
+      --trim_front2=10 \
+      --disable_adapter_trimming \
+      --qualified_quality_phred 20 \
+      --disable_length_filtering \
+      --detect_adapter_for_pe \
+      ${params.fastp} \
+      --out1 ${file_prefix}_R1_trim.fastq.gz \
+      --out2 ${file_prefix}_R2_trim.fastq.gz \
+      --html ${file_prefix}.html \
+      --json ${file_prefix}_fastp.json \
+      --report_title ${file_prefix}
+  """
+  else
+  """
+  fastp --thread ${task.cpus} \
+    --disable_quality_filtering \
+    --disable_length_filtering \
+    --disable_trim_poly_g \
+    --detect_adapter_for_pe \
+    --stdout \
+    --in1 ${reads[0]} 2> /dev/null  | \
+    fastp --thread ${task.cpus} \
+      --disable_adapter_trimming \
+      --stdin \
+      --trim_front1=10 \
+      --qualified_quality_phred 20 \
+      --disable_length_filtering \
+      --detect_adapter_for_pe \
+      ${params.fastp} \
+      --out1 ${file_prefix}_trim.fastq.gz \
+      --html ${file_prefix}.html \
+      --json ${file_prefix}_fastp.json \
+      --report_title ${file_prefix}
+  """
+}
+

src/nf_modules/fastq_screen/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.11.3--pl5.22.0_0"
+container_url = "quay.io/biocontainers/fastq-screen:${version}"
+
+params.fastq_screen = ""
+params.fastq_screen_out = ""
+process fastq_screen {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.index_fasta_out != "") {
+    publishDir "results/${params.fastq_screen_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(fastq)
+
+  output:
+    tuple val(file_id), path("*"), emit: output
+
+  script:
+"""
+fastq_screen --get_genomes
+fastq_screen --threads ${task.cpus} sample1.fastq sample2.fastq
+"""
+}

src/nf_modules/fastqc/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.11.5"
+container_url = "lbmc/fastqc:${version}"
+
+params.fastqc_fastq = ""
+params.fastqc_fastq_out = ""
+process fastqc_fastq {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.fastqc_fastq_out != "") {
+    publishDir "results/${params.fastqc_fastq_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(reads)
+
+  output:
+  tuple val(file_id), path("*.{zip,html}"), emit: report
+
+  script:
+  if (reads.size() == 2)
+  """
+  fastqc --quiet --threads ${task.cpus} --format fastq --outdir ./ \
+    ${params.fastqc_fastq} \
+    ${reads[0]} ${reads[1]}
+  """
+  else
+  """
+    fastqc --quiet --threads ${task.cpus} --format fastq --outdir ./ ${params.fastqc_fastq} ${reads[0]}
+  """
+}
\ No newline at end of file

src/nf_modules/flexi_splitter/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "1.0.2"
+container_url = "lbmc/flexi_splitter:${version}"
+
+params.split = ""
+params.split_out = ""
+
+
+workflow split {
+  take:
+    reads
+    config
+  main:
+    split_fastq(reads, config)
+    group_fastq(split_fastq.out.fastq_folder)
+    group_fastq.out.fastq
+      .map{ it -> it[1] }
+      .flatten()
+      .collate(2)
+      .map{ it -> [it[0].simpleName - ~/_{0,1}R[12]/, it]}
+      .set{ splited_fastq }
+
+  emit:
+    fastq = splited_fastq
+}
+
+process split_fastq {
+  // You can get an example of config file here:
+  // src/nf_modules/flexi_splitter/marseq_flexi_splitter.yaml
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.split_out != "") {
+    publishDir "results/${params.split_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(reads)
+  tuple val(config_id), path(config)
+
+  output:
+  tuple val(file_id), path("split"), emit: fastq_folder
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+
+  if (reads.size() == 2)
+  """
+  flexi_splitter ${params.split} -n 2 -f ${reads[0]},${reads[1]} -o split -c ${config}
+  """
+  else
+  """
+  flexi_splitter ${params.split} -n 1 -f ${reads[0]} -o split -c ${config}
+  """
+}
+
+process group_fastq {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.split_out != "") {
+    publishDir "results/${params.split_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(reads_folder)
+
+  output:
+  tuple val(file_id), path("results/*"), emit: fastq
+
+  script:
+"""
+mkdir -p results/
+find split/ -type "f" | \
+  grep -v "unassigned" | \
+  sed -E "s|(split/(.*)/(.*))|\\1 \\2_\\3|g" |
+  awk '{system("mv "\$1" results/"\$2)}'
+"""
+}
\ No newline at end of file

src/nf_modules/flexi_splitter/marseq_flexi_splitter.yaml

+# SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+#
+# SPDX-License-Identifier: AGPL-3.0-or-later
+
+PLATE:
+  coords:
+    reads: 0
+    start: 1
+    stop: 4
+    header: False
+  samples:
+    - name : Plate1
+      seq: GACT
+    - name : Plate2
+      seq: CATG
+    - name : Plate3
+      seq: CCAA
+    - name : Plate4
+      seq: CTGT
+    - name : Plate5
+      seq: GTAG
+    - name : Plate6
+      seq: TGAT
+    - name : Plate7
+      seq: ATCA
+    - name : Plate8
+      seq: TAGA
+
+conditions:
+    - Plate1 :
+      Plate1
+    - Plate2 :
+      Plate2
+    - Plate3 :
+      Plate3
+    - Plate4 :
+      Plate4
+    - Plate5 :
+      Plate5
+    - Plate6 :
+      Plate6
+    - Plate7 :
+      Plate7
+    - Plate8 :
+      Plate8

src/nf_modules/flexi_splitter/toy_file_paired.yaml

+# SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+#
+# SPDX-License-Identifier: AGPL-3.0-or-later
+
+PCR:
+  coords:
+    reads: 3
+    start: 1
+    stop: 6
+    header: False
+  samples:
+    - name : PCR1
+      seq: NCAGTG
+    - name : PCR2
+      seq : CGATGT
+    - name : PCR3
+      seq: TTAGGC
+    - name : PCR4
+      seq : TGACCA
+    - name: PCR5
+      seq: NGAACG
+    - name: PCR6
+      seq: NCAACA
+RT:
+  coords:
+    reads: 1
+    start: 6
+    stop: 13
+    header: False
+  samples:
+    - name : RT1
+      seq: TAGTGCC
+    - name : RT2
+      seq: GCTACCC
+    - name: RT3
+      seq: ATCGACC
+    - name: RT4
+      seq: CGACTCC
+UMI:
+  coords:
+    reads: 1
+    start: 1
+    stop: 6
+    header: False
+conditions:
+  wt:
+    - RT1
+    - PCR1
+  ko:
+    - RT2
+    - PCR2
+  sample_paired:
+    - RT2
+    - PCR6

src/nf_modules/g2gtools/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.2.8"
+container_url = "lbmc/g2gtools:${version}"
+
+params.vci_build = ""
+params.vci_build_out = ""
+process vci_build {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.vci_build_out != "") {
+    publishDir "results/${params.vci_build_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta)
+  output:
+    tuple val(file_id), path("*.vci.gz"), path("*.vci.gz.tbi"), emit: vci
+    tuple val(file_id), path("*_report.txt"), emit: report
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+
+  input_vcf = ""
+  for (vcf_file in vcf) {
+    input_vcf += " -i ${vcf_file}"
+  }
+"""
+g2gtools vcf2vci \
+  ${params.vci_build} \
+  -p ${task.cpus} \
+  -f ${fasta} \
+  ${input_vcf} \
+  -s ${file_prefix} \
+  -o ${file_prefix}.vci 2> ${file_prefix}_g2gtools_vcf2vci_report.txt
+"""
+}
+
+params.incorporate_snp = ""
+params.incorporate_snp_out = ""
+process incorporate_snp {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.incorporate_snp_out != "") {
+    publishDir "results/${params.incorporate_snp_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vci), path(tbi)
+    tuple val(ref_id), path(fasta)
+  output:
+    tuple val(file_id), path("${file_prefix}_snp.fa"), path("${vci}"), path("${tbi}"), emit: fasta
+    tuple val(file_id), path("*_report.txt"), emit: report
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+g2gtools patch \
+  ${params.incorporate_snp} \
+  -p ${task.cpus} \
+  -i ${fasta} \
+  -c ${vci} \
+  -o ${file_prefix}_snp.fa 2> ${file_prefix}_g2gtools_path_report.txt
+"""
+}
+
+params.incorporate_indel = ""
+params.incorporate_indel_out = ""
+process incorporate_indel {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.incorporate_indel_out != "") {
+    publishDir "results/${params.incorporate_indel_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(fasta), path(vci), path(tbi)
+  output:
+    tuple val(file_id), path("${file_prefix}_snp_indel.fa"), path("${vci}"), path("${tbi}"), emit: fasta
+    tuple val(file_id), path("*_report.txt"), emit: report
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+g2gtools transform \
+  ${params.incorporate_indel} \
+  -p ${task.cpus} \
+  -i ${fasta} \
+  -c ${vci} \
+  -o ${file_prefix}_snp_indel.fa 2> ${file_prefix}_g2gtools_transform_report.txt
+"""
+}
+
+params.convert_gtf = ""
+params.convert_gtf_out = ""
+process convert_gtf {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.convert_gtf_out != "") {
+    publishDir "results/${params.convert_gtf_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vci), path(tbi)
+    tuple val(annot_id), path(gtf)
+  output:
+    tuple val(file_id), path("${file_prefix}.gtf"), emit: gtf
+    tuple val(file_id), path("*_report.txt"), emit: report
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+g2gtools convert \
+  ${params.convert_gtf} \
+  -i ${gtf} \
+  -c ${vci} \
+  -o ${file_prefix}.gtf 2> ${file_prefix}_g2gtools_convert_report.txt
+"""
+}
+
+params.convert_bed = ""
+params.convert_bed_out = ""
+process convert_bed {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.convert_bed_out != "") {
+    publishDir "results/${params.convert_bed_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vci), path(tbi)
+    tuple val(annot_id), path(bed)
+  output:
+    tuple val(file_id), path("${file_id}.bed"), emit: bed
+    tuple val(file_id), path("*_report.txt"), emit: report
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+g2gtools convert \
+  ${params.convert_bed} \
+  -i ${bed} \
+  -c ${vci} \
+  -o ${file_id}.bed 2> ${file_id}_g2gtools_convert_report.txt
+"""
+}
+
+params.convert_bam = ""
+params.convert_bam_out = ""
+process convert_bam {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "${bam_id} ${file_id}"
+  if (params.convert_bam_out != "") {
+    publishDir "results/${params.convert_bam_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vci), path(tbi)
+    tuple val(bam_id), path(bam)
+  output:
+    tuple val(file_id), path("${file_id}_${bam_id.baseName}.bam"), emit: bam
+    tuple val(file_id), path("*_report.txt"), emit: report
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+g2gtools convert \
+  ${params.convert_bam} \
+  -i ${bam} \
+  -c ${vci} \
+  -o ${file_id}_${bam.baseName}.bam 2> ${file_id}_g2gtools_convert_report.txt
+"""
+}
\ No newline at end of file

src/nf_modules/gatk3/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "3.8.0"
+container_url = "lbmc/gatk:${version}"
+
+params.variant_calling = ""
+params.variant_calling_out = ""
+process variant_calling {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.variant_calling_out != "") {
+    publishDir "results/${params.variant_calling_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(bam), path(bai)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*.vcf"), emit: vcf
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+gatk3 -T HaplotypeCaller \
+  -nct ${task.cpus} \
+  ${params.variant_calling} \
+  -R ${fasta} \
+  -I ${bam} \
+  -o ${file_prefix}.vcf
+"""
+}
+
+params.filter_snp = ""
+params.filter_snp_out = ""
+process filter_snp {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.filter_snp_out != "") {
+    publishDir "results/${params.filter_snp_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_snp.vcf"), emit: vcf
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+gatk3 -T SelectVariants \
+  -nct ${task.cpus} \
+  ${params.filter_snp} \
+  -R ${fasta} \
+  -V ${vcf} \
+  -selectType SNP \
+  -o ${file_prefix}_snp.vcf
+"""
+}
+
+params.filter_indels = ""
+params.filter_indels_out = ""
+process filter_indels {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.filter_indels_out != "") {
+    publishDir "results/${params.filter_indels_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_indel.vcf"), emit: vcf
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+gatk3 -T SelectVariants \
+  -nct ${task.cpus} \
+  ${params.filter_indels} \
+  -R ${fasta} \
+  -V ${vcf} \
+  -selectType INDEL \
+  -o ${file_prefix}_indel.vcf
+"""
+}
+
+params.high_confidence_snp_filter = "(QD < 2.0) || (FS > 60.0) || (MQ < 40.0) || (MQRankSum < -12.5) || (ReadPosRankSum < -8.0) || (SOR > 4.0)"
+params.high_confidence_snp = "--filterExpression \"${params.high_confidence_snp_filter}\" --filterName \"basic_snp_filter\""
+params.high_confidence_snp_out = ""
+process high_confidence_snp {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.high_confidence_snp_out != "") {
+    publishDir "results/${params.high_confidence_snp_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_snp.vcf"), emit: vcf
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+gatk3 -T VariantFiltration \
+  -nct ${task.cpus} \
+  -R ${fasta} \
+  -V ${vcf} \
+  ${params.high_confidence_snp} \
+  -o ${file_prefix}_filtered_snp.vcf
+"""
+}
+
+params.high_confidence_indel_filter = "QD < 3.0 || FS > 200.0 || ReadPosRankSum < -20.0 || SOR > 10.0"
+params.high_confidence_indels = "--filterExpression \"${params.high_confidence_indel_filter}\" --filterName \"basic_indel_filter\""
+params.high_confidence_indels_out = ""
+process high_confidence_indels {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.high_confidence_indels_out != "") {
+    publishDir "results/${params.high_confidence_indels_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_indel.vcf"), emit: vcf
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+gatk3 -T VariantFiltration \
+  -nct ${task.cpus} \
+  -R ${fasta} \
+  -V ${vcf} \
+  ${params.high_confidence_indels} \
+  -o ${file_prefix}_filtered_indel.vcf
+"""
+}
+
+params.recalibrate_snp_table = ""
+params.recalibrate_snp_table_out = ""
+process recalibrate_snp_table {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.recalibrate_snp_table_out != "") {
+    publishDir "results/${params.recalibrate_snp_table_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(snp_file), path(indel_file), path(bam), path(bam_idx)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("recal_data_table"), emit: recal_table
+  script:
+"""
+gatk3 -T BaseRecalibrator \
+  -nct ${task.cpus} \
+  ${recalibrate_snp_table} \
+  -R ${fasta} \
+  -I ${bam} \
+  -knownSites ${snp_file} \
+  -knownSites ${indel_file} \
+  -o recal_data_table
+"""
+}
+
+params.recalibrate_snp = ""
+params.recalibrate_snp_out = ""
+process recalibrate_snp {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.recalibrate_snp_out != "") {
+    publishDir "results/${params.recalibrate_snp_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(snp_file), path(indel_file), path(bam), path(bam_idx)
+    tuple val(table_id), path(recal_data_table)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*.bam"), emit: bam
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+gatk3 -T PrintReads \
+  --use_jdk_deflater \
+  --use_jdk_inflater \
+  ${recalibrate_snp} \
+  -nct ${task.cpus} \
+  -R ${fasta} \
+  -I ${bam} \
+  -BQSR recal_data_table \
+  -o ${file_prefix}_recal.bam
+"""
+}
+
+params.haplotype_caller = ""
+params.haplotype_caller_out = ""
+process haplotype_caller {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.haplotype_caller_out != "") {
+    publishDir "results/${params.haplotype_caller_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(bam)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*.gvcf"), emit: gvcf
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+gatk3 -T HaplotypeCaller \
+  -nct ${task.cpus} \
+  ${params.haplotype_caller} \
+  -R ${fasta} \
+  -I ${bam} \
+  -ERC GVCF \
+  -variant_index_type LINEAR -variant_index_parameter 128000 \
+  -o ${file_prefix}.gvcf
+"""
+}
+
+params.gvcf_genotyping = ""
+params.gvcf_genotyping_out = ""
+process gvcf_genotyping {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.gvcf_genotyping_out != "") {
+    publishDir "results/${params.gvcf_genotyping_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(gvcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*.vcf"), emit: vcf
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+gatk3 -T GenotypeGVCFs \
+  -nct ${task.cpus} \
+  ${params.gvcf_genotyping} \
+  -R ${fasta} \
+  -V ${gvcf} \
+  -o ${file_prefix}_joint.vcf
+"""
+}
+
+params.select_variants_snp = ""
+params.select_variants_snp_out = ""
+process select_variants_snp {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.select_variants_snp_out != "") {
+    publishDir "results/${params.select_variants_snp_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_joint_snp.vcf"), emit: vcf
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+gatk3 -T SelectVariants \
+  -nct ${task.cpus} \
+  ${params.select_variants_snp} \
+  -R ${fasta} \
+  -V ${vcf} \
+  -selectType SNP \
+  -o ${file_prefix}_joint_snp.vcf
+"""
+}
+
+params.select_variants_indels = ""
+params.select_variants_indels_out = ""
+process select_variants_indels {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.select_variants_indels_out != "") {
+    publishDir "results/${params.select_variants_indels_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_joint_indel.vcf"), emit: vcf
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+gatk3 -T SelectVariants \
+  -nct ${task.cpus} \
+  ${params.select_variants_indels} \
+  -R ${fasta} \
+  -V ${vcf} \
+  -selectType INDEL \
+  -o ${file_prefix}_joint_indel.vcf
+"""
+}
+
+params.personalized_genome = ""
+params.personalized_genome_out = ""
+process personalized_genome {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.personalized_genome_out != "") {
+    publishDir "results/${params.personalized_genome_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_genome.fasta"), emit: fasta
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+"""
+gatk3 -T FastaAlternateReferenceMaker\
+  ${params.personalized_genome} \
+  -R ${reference} \
+  -V ${vcf} \
+  -o ${file_prefix}_genome.fasta
+"""
+}
+

src/nf_modules/gatk4/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "4.2.0.0"
+container_url = "broadinstitute/gatk:${version}"
+
+def get_file_prefix(file_id) {
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else if (file_id instanceof Map) {
+      library = file_id[0]
+      file_prefix = file_id[0]
+      if (file_id.containsKey('library')) {
+        library = file_id.library
+        file_prefix = file_id.id
+      }
+  } else {
+    file_prefix = file_id
+  }
+  return file_prefix
+}
+
+include {
+  index_fasta as samtools_index_fasta;
+  index_bam;
+} from './../samtools/main.nf'
+include {
+  index_fasta as picard_index_fasta;
+  index_bam as picard_index_bam;
+  mark_duplicate;
+} from './../picard/main.nf'
+
+params.variant_calling_out = ""
+workflow germline_cohort_data_variant_calling {
+  take:
+    bam
+    fasta
+  main:
+    // data preparation
+    mark_duplicate(bam)
+    index_bam(mark_duplicate.out.bam)
+    picard_index_bam(mark_duplicate.out.bam)
+    index_bam.out.bam_idx
+      .join(picard_index_bam.out.index)
+      .set{ bam_idx }
+    picard_index_fasta(fasta)
+    samtools_index_fasta(fasta)
+    fasta
+      .join(picard_index_fasta.out.index)
+      .join(samtools_index_fasta.out.index)
+      .set{ fasta_idx }
+    
+    // variant calling
+    call_variants_per_sample(
+      bam_idx,
+      fasta_idx.collect()
+    )
+    call_variants_all_sample(
+      call_variants_per_sample.out.gvcf,
+      fasta_idx
+    )
+  emit:
+    vcf = call_variants_all_sample.out.vcf
+}
+
+/*******************************************************************/
+workflow base_quality_recalibrator{
+  take:
+    bam_idx
+    fasta_idx
+    vcf
+
+  main:
+    index_vcf(vcf)
+    compute_base_recalibration(
+      bam_idx,
+      fasta_idx,
+      index_vcf.out.vcf_idx
+    ) 
+    apply_base_recalibration(
+      bam_idx,
+      fasta_idx,
+      compute_base_recalibration.out.table
+    )
+    emit:
+    bam = apply_base_recalibration.out.bam
+}
+
+process index_vcf {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  input:
+    tuple val(file_id), path(vcf)
+  output:
+    tuple val(file_id), path("${vcf}"), path("*"), emit: vcf_idx
+
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" IndexFeatureFile \
+  -I ${vcf}
+"""
+}
+
+process compute_base_recalibration {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  input:
+    tuple val(file_id), path(bam), path(bam_idx), path(bam_idx_bis)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+    tuple val(vcf_id), path(vcf), path(vcf_idx)
+  output:
+    tuple val(file_id), path("${bam.simpleName}.table"), emit: table
+
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+  def vcf_cmd = ""
+  if (vcf instanceof List){
+    for (vcf_file in vcf){
+      vcf_cmd += "--known-sites ${vcf_file} "
+    }
+  } else {
+    vcf_cmd = "--known-sites ${vcf} "
+  }
+"""
+ gatk --java-options "-Xmx${xmx_memory}G" BaseRecalibrator \
+   -I ${bam} \
+   -R ${fasta} \
+   ${vcf_cmd} \
+   -O ${bam.simpleName}.table
+"""
+}
+
+process apply_base_recalibration {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  input:
+    tuple val(file_id), path(bam), path(bam_idx), path(bam_idx_bis)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+    tuple val(table_id), path(table)
+  output:
+    tuple val(file_id), path("${bam.simpleName}_recalibrate.bam"), emit: bam
+
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+ gatk --java-options "-Xmx${xmx_memory}G" ApplyBQSR \
+   -R ${fasta} \
+   -I ${bam} \
+   --bqsr-recal-file ${table} \
+   -O ${bam.simpleName}_recalibrate.bam
+"""
+}
+
+/*******************************************************************/
+params.variant_calling_gvcf_out = ""
+process call_variants_per_sample {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.variant_calling_gvcf_out != "") {
+    publishDir "results/${params.variant_calling_gvcf_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(bam), path(bam_idx), path(bam_idx_bis)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("${bam.simpleName}.gvcf.gz"), emit: gvcf
+
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+ gatk --java-options "-Xmx${xmx_memory}G" HaplotypeCaller  \
+   -R ${fasta} \
+   -I ${bam} \
+   -O ${bam.simpleName}.gvcf.gz \
+   -ERC GVCF
+"""
+}
+
+/*******************************************************************/
+
+workflow call_variants_all_sample {
+  take:
+    gvcf
+    fasta_idx
+
+  main:
+    index_gvcf(gvcf)
+    validate_gvcf(
+      index_gvcf.out.gvcf_idx,
+      fasta_idx.collect()
+    )
+    consolidate_gvcf(
+      validate_gvcf.out.gvcf
+      .groupTuple(),
+      fasta_idx.collect()
+    )
+    genomic_db_call(
+      consolidate_gvcf.out.gvcf_idx,
+      fasta_idx.collect()
+    )
+  emit:
+    vcf = genomic_db_call.out.vcf
+}
+
+process index_gvcf {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  input:
+    tuple val(file_id), path(gvcf)
+  output:
+    tuple val(file_id), path("${gvcf}"), path("${gvcf}.tbi"), emit: gvcf_idx
+    tuple val(file_id), path("${gvcf.simpleName}_IndexFeatureFile_report.txt"), emit: report
+
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" IndexFeatureFile \
+      -I ${gvcf} 2> ${gvcf.simpleName}_IndexFeatureFile_report.txt
+"""
+}
+
+process validate_gvcf {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  input:
+    tuple val(file_id), path(gvcf), path(gvcf_idx)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("${gvcf}"), path("${gvcf_idx}"), emit: gvcf
+
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" ValidateVariants \
+   -V ${gvcf} \
+   -R ${fasta} -gvcf
+"""
+}
+
+process consolidate_gvcf {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  input:
+    tuple val(file_id), path(gvcf), path(gvcf_idx)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("${file_prefix}.gvcf"), path("${file_prefix}.gvcf.idx"), emit: gvcf_idx
+    tuple val(file_id), path("${file_prefix}_CombineGVCFs_report.txt"), emit: report
+
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+  def gvcf_cmd = ""
+  if (gvcf instanceof List){
+    for (gvcf_file in gvcf){
+      gvcf_cmd += "-V ${gvcf_file} "
+    }
+  } else {
+    gvcf_cmd = "-V ${gvcf} "
+  }
+"""
+mkdir tmp
+gatk --java-options "-Xmx${xmx_memory}G" CombineGVCFs \
+    ${gvcf_cmd} \
+    -R ${fasta} \
+    -O ${file_prefix}.gvcf 2> ${file_prefix}_CombineGVCFs_report.txt
+gatk --java-options "-Xmx${xmx_memory}G" IndexFeatureFile \
+      -I ${file_prefix}.gvcf 2> ${file_prefix}_IndexFeatureFile_report.txt
+"""
+}
+
+process genomic_db_call {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.variant_calling_out != "") {
+    publishDir "results/${params.variant_calling_out}", mode: 'copy'
+  }
+  input:
+    tuple val(file_id), path(gvcf), path(gvcf_idx)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("${gvcf.simpleName}.vcf.gz"), emit: vcf
+
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+  def gvcf_cmd = ""
+  if (gvcf instanceof List){
+    for (gvcf_file in gvcf){
+      gvcf_cmd += "--V ${gvcf_file} "
+    }
+  } else {
+    gvcf_cmd = "--V ${gvcf} "
+  }
+"""
+mkdir tmp
+gatk --java-options "-Xmx${xmx_memory}G" GenotypeGVCFs \
+   -R ${fasta} \
+   -V ${gvcf} \
+   -O ${gvcf.simpleName}.vcf.gz \
+   --tmp-dir ./tmp
+"""
+}
+
+/*******************************************************************/
+params.variant_calling = ""
+process variant_calling {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.variant_calling_out != "") {
+    publishDir "results/${params.variant_calling_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(bam), path(bai)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*.vcf"), emit: vcf
+
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" HaplotypeCaller \
+  ${params.variant_calling} \
+  -R ${fasta} \
+  -I ${bam} \
+  -O ${bam.simpleName}.vcf
+"""
+}
+
+params.filter_snp = ""
+params.filter_snp_out = ""
+process filter_snp {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.filter_snp_out != "") {
+    publishDir "results/${params.filter_snp_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_snp.vcf"), emit: vcf
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" SelectVariants \
+  ${params.filter_snp} \
+  -R ${fasta} \
+  -V ${vcf} \
+  -select-type SNP \
+  -O ${vcf.simpleName}_snp.vcf
+"""
+}
+
+params.filter_indels = ""
+params.filter_indels_out = ""
+process filter_indels {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.filter_indels_out != "") {
+    publishDir "results/${params.filter_indels_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_indel.vcf"), emit: vcf
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" SelectVariants \
+  ${params.filter_indels} \
+  -R ${fasta} \
+  -V ${vcf} \
+  -select-type INDEL \
+  -O ${vcf.simpleName}_indel.vcf
+"""
+}
+
+params.high_confidence_snp_filter = "(QD < 2.0) || (FS > 60.0) || (MQ < 40.0) || (MQRankSum < -12.5) || (ReadPosRankSum < -8.0) || (SOR > 4.0)"
+params.high_confidence_snp = "--filter-expression \"${params.high_confidence_snp_filter}\" --filter-name \"basic_snp_filter\""
+params.high_confidence_snp_out = ""
+process high_confidence_snp {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.high_confidence_snp_out != "") {
+    publishDir "results/${params.high_confidence_snp_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_snp.vcf"), emit: vcf
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" VariantFiltration \
+  -R ${fasta} \
+  -V ${vcf} \
+  ${params.high_confidence_snp} \
+  -O ${vcf.simpleName}_filtered_snp.vcf
+"""
+}
+
+params.high_confidence_indel_filter = "QD < 3.0 || FS > 200.0 || ReadPosRankSum < -20.0 || SOR > 10.0"
+params.high_confidence_indels = "--filter-expression \"${params.high_confidence_indel_filter}\" --filter-name \"basic_indel_filter\""
+params.high_confidence_indels_out = ""
+process high_confidence_indels {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.high_confidence_indels_out != "") {
+    publishDir "results/${params.high_confidence_indels_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_indel.vcf"), emit: vcf
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" VariantFiltration \
+  -R ${fasta} \
+  -V ${vcf} \
+  ${params.high_confidence_indels} \
+  -O ${vcf.simpleName}_filtered_indel.vcf
+"""
+}
+
+params.recalibrate_snp_table = ""
+params.recalibrate_snp_table_out = ""
+process recalibrate_snp_table {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.recalibrate_snp_table_out != "") {
+    publishDir "results/${params.recalibrate_snp_table_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(snp_file), path(indel_file), path(bam), path(bam_idx), path(bam_idx_bis)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("recal_data_table"), emit: recal_table
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" IndexFeatureFile \
+  -I ${snp_file}
+gatk --java-options "-Xmx${xmx_memory}G" IndexFeatureFile \
+  -I ${indel_file}
+gatk --java-options "-Xmx${xmx_memory}G" BaseRecalibrator \
+  ${params.recalibrate_snp_table} \
+  -R ${fasta} \
+  -I ${bam} \
+  -known-sites ${snp_file} \
+  -known-sites ${indel_file} \
+  -O recal_data_table
+"""
+}
+
+params.recalibrate_snp = ""
+params.recalibrate_snp_out = ""
+process recalibrate_snp {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.recalibrate_snp_out != "") {
+    publishDir "results/${params.recalibrate_snp_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(snp_file), path(indel_file), path(bam), path(bam_idx), path(recal_table)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*.bam"), emit: bam
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" ApplyBQSR \
+  ${params.recalibrate_snp} \
+  -R ${fasta} \
+  -I ${bam} \
+  --bqsr-recal-file recal_data_table \
+  -O ${bam.simpleName}_recal.bam
+"""
+}
+
+params.haplotype_caller = ""
+params.haplotype_caller_out = ""
+process haplotype_caller {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.haplotype_caller_out != "") {
+    publishDir "results/${params.haplotype_caller_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(bam)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*.gvcf"), emit: gvcf
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" HaplotypeCaller \
+  ${params.haplotype_caller} \
+  -R ${fasta} \
+  -I ${bam} \
+  -ERC GVCF \
+  -O ${bam.simpleName}.gvcf
+"""
+}
+
+params.gvcf_genotyping = ""
+params.gvcf_genotyping_out = ""
+process gvcf_genotyping {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.gvcf_genotyping_out != "") {
+    publishDir "results/${params.gvcf_genotyping_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(gvcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*.vcf.gz"), emit: vcf
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" GenotypeGVCFs \
+  ${params.gvcf_genotyping} \
+  -R ${fasta} \
+  -V ${gvcf} \
+  -O ${gvcf.simpleName}_joint.vcf.gz
+"""
+}
+
+params.select_variants_snp = ""
+params.select_variants_snp_out = ""
+process select_variants_snp {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.select_variants_snp_out != "") {
+    publishDir "results/${params.select_variants_snp_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_joint_snp.vcf"), emit: vcf
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}GG" SelectVariants \
+  ${params.select_variants_snp} \
+  -R ${fasta} \
+  -V ${vcf} \
+  -select-type SNP \
+  -O ${vcf.simpleName}_joint_snp.vcf
+"""
+}
+
+params.select_variants_indels = ""
+params.select_variants_indels_out = ""
+process select_variants_indels {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.select_variants_indels_out != "") {
+    publishDir "results/${params.select_variants_indels_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_joint_indel.vcf"), emit: vcf
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" SelectVariants \
+  ${params.select_variants_indels} \
+  -R ${fasta} \
+  -V ${vcf} \
+  -select-type INDEL \
+  -O ${file_prefix}_joint_indel.vcf
+"""
+}
+
+params.personalized_genome = ""
+params.personalized_genome_out = ""
+process personalized_genome {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.personalized_genome_out != "") {
+    publishDir "results/${params.personalized_genome_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(fasta), path(fai), path(dict)
+  output:
+    tuple val(file_id), path("*_genome.fasta"), emit: fasta
+
+  script:
+  xmx_memory = "${task.memory}" - ~/\s*GB/
+  file_prefix = get_file_prefix(file_id)
+"""
+gatk --java-options "-Xmx${xmx_memory}G" FastaAlternateReferenceMaker\
+  ${params.personalized_genome} \
+  -R ${reference} \
+  -V ${vcf} \
+  -O ${vcf.simpleName}_genome.fasta
+"""
+}
+
+
+

src/nf_modules/gffread/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.12.2"
+container_url = "lbmc/gffread:${version}"
+
+params.gffread = ""
+params.gffread_out = ""
+process gffread {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_prefix"
+  if (params.gffread_out != "") {
+    publishDir "results/${params.gffread_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(gtf)
+  tuple val(fasta_id), path(fasta)
+
+  output:
+    tuple val(fasta_id), path("${file_prefix}.fasta"), emit: fasta
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+  """
+  gffread ${gtf} -g ${fasta} -M -x dup_${file_prefix}.fasta
+  awk 'BEGIN {i = 1;} { if (\$1 ~ /^>/) { tmp = h[i]; h[i] = \$1; } else if (!a[\$1]) { s[i] = \$1; a[\$1] = "1"; i++; } else { h[i] = tmp; } } END { for (j = 1; j < i; j++) { print h[j]; print s[j]; } }' < dup_${file_prefix}.fasta | grep -v -e "^\$" > ${file_prefix}.fasta
+  """
+}
+
+params.spliced_cds = ""
+params.spliced_cds_out = ""
+process spliced_cds {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_prefix"
+  if (params.spliced_cds_out != "") {
+    publishDir "results/${params.spliced_cds_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(gtf)
+  tuple val(fasta_id), path(fasta)
+
+  output:
+    tuple val(fasta_id), path("${file_prefix}.fasta"), emit: fasta
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+  """
+gzip -dck ${fasta} > ${fasta.simpleName}_un.fasta
+gzip -dck ${gtf} > ${gtf.simpleName}_un.gtf
+gffread ${gtf.simpleName}_un.gtf -g ${fasta.simpleName}_un.fasta -M \
+  -x ${file_prefix}.fasta
+  """
+}
\ No newline at end of file

src/nf_modules/guppy-cpu/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "5.0.11"
+container_url = "lbmc/guppy-cpu:${version}"
+
+params.basecalling_out = ""
+params.flowcell = "FLO-MIN106"
+params.kit = "SQK-PCS109"
+params.cpu_threads_per_caller = 4
+params.num_callers = 1
+process basecall_fast5 {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.basecalling_out != "") {
+    publishDir "results/${params.basecalling_out}", mode: 'copy'
+  }
+
+  if (params.flowcell == "") {
+      errorFlowcell << "WARNING ! No Flowcell type given..."
+      errorFlowcell.view()
+  }
+
+  if (params.kit == "") {
+      errorKit "WARNING ! No kit type given..."
+      errorKit.view()
+  }
+
+  input:
+    tuple val(file_id), path(fast5)
+
+  output:
+    tuple val(file_id), path("*.fastq*"), emit: fastq
+
+  script:
+"""
+guppy_basecaller --compress_fastq \
+    -i ${path(fast5)} \
+    -s ${params.basecalling_out} \
+    --cpu_threads_per_caller ${params.cpu_threads_per_caller} \
+    --num_callers ${params.num_callers} \
+    --flowcell ${params.flowcell} \
+    --kit ${params.kit}
+"""
+}
\ No newline at end of file