src/example_chipseq.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+nextflow.enable.dsl=2
+
+include {
+  fastp
+} from './nf_modules/fastp/main'
+
+workflow csv_parsing {
+  if (params.csv_path.size() > 0) {
+    log.info "loading local csv files"
+    Channel
+      .fromPath(params.csv_path, checkIfExists: true)
+      .ifEmpty { error 
+      log.error """
+    =============================================================
+      WARNING! No csv input file precised.
+      Use '--csv_path <file.csv>'
+      Or '--help' for more informations
+    =============================================================
+    """
+      }
+      .splitCsv(header: true, sep: ";", strip: true)
+      .flatMap{
+        it -> [
+          [(it.IP + it.WCE).md5(), "IP", "w", file(it.IP)],
+          [(it.IP + it.WCE).md5(), "WCE", "w", file(it.WCE)]
+        ]
+      }
+      .map{ it ->
+        if (it[1] instanceof List){
+          it
+        } else {
+          [it[0], [it[1]], it[2], it[3], [it[4]]]
+        }
+      }
+      .map{
+        it ->
+        if (it[1].size() == 2){ // if data are paired_end
+          [
+            "index": it[0],
+            "group": ref_order(it),
+            "ip": it[2],
+            "type": it[3],
+            "id": read_order(it)[0],
+            "file": read_order(it)
+          ]
+        } else {
+          [
+            "index": it[0],
+            "group": it[1].simpleName,
+            "ip": it[2],
+            "type": it[3],
+            "id": it[4].simpleName,
+            "file": [it[4].simpleName, it[4]]
+          ]
+        }
+      }
+      .set{input_csv}
+  } else {
+    log.info "loading remotes SRA csv files"
+    Channel
+      .fromPath(params.csv_sra, checkIfExists: true)
+      .ifEmpty { error 
+      log.error """
+    =============================================================
+      WARNING! No csv input file precised.
+      Use '--csv_path <file.csv>' or
+      Use '--csv_SRA <file.csv>'
+      Or '--help' for more informations
+    =============================================================
+    """
+      }
+      .splitCsv(header: true, sep: ";", strip: true)
+      .flatMap{
+        it -> [
+          [[it.IP_w + it.WCE_w + it.IP_m + it.WCE_m], t.IP_w, "IP", "w", it.IP_w],
+          [[it.IP_w + it.WCE_w + it.IP_m + it.WCE_m], it.IP_w, "WCE", "w", it.WCE_w],
+          [[it.IP_w + it.WCE_w + it.IP_m + it.WCE_m], it.IP_w, "IP", "m", it.IP_m],
+          [[it.IP_w + it.WCE_w + it.IP_m + it.WCE_m], it.IP_w, "WCE", "m", it.WCE_m]
+        ]
+      }
+      .map{
+        it ->
+        if (it[1].size() == 2){ // if data are paired_end
+          [
+            "index": (
+              it[0][0][0].simpleName +
+              it[0][0][1].simpleName +
+              it[0][0][2].simpleName +
+              it[0][0][3].simpleName
+            ).md5(),
+            "group": it[1][0].simpleName,
+            "ip": it[2],
+            "type": it[3],
+            "id": it[4][0].simpleName[0..-4],
+            "file": [it[4][0].simpleName[0..-4], it[4]]
+          ]
+        } else {
+          [
+            "index": (
+              it[0][0].simpleName +
+              it[0][1].simpleName +
+              it[0][2].simpleName +
+              it[0][3].simpleName
+            ).md5(),
+            "group": it[1].simpleName,
+            "ip": it[2],
+            "type": it[3],
+            "id": it[4].simpleName,
+            "file": [it[4].simpleName, it[4]]
+          ]
+        }
+      }
+      .set{input_csv}
+  }
+  emit:
+  input_csv
+}
+
+
+workflow {
+
+}
\ No newline at end of file

src/example_marseq.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 nextflow.enable.dsl=2
 
 /*
@@ -16,9 +20,9 @@ include {
   count_velocity_out: "quantification_velocity/"
 )
 
-params.fasta = "http://ftp.ensembl.org/pub/release-94/fasta/gallus_gallus/dna/Gallus_gallus.Gallus_gallus-5.0.dna.toplevel.fa.gz"
+params.fasta = "http://ftp.ensembl.org/pub/release-98/fasta/gallus_gallus/dna/Gallus_gallus.GRCg6a.dna.toplevel.fa.gz"
 params.fastq = "data/CF42_45/*/*R{1,2}.fastq.gz"
-params.gtf = "http://ftp.ensembl.org/pub/release-94/gtf/gallus_gallus/Gallus_gallus.Gallus_gallus-5.0.94.gtf.gz"
+params.gtf = "http://ftp.ensembl.org/pub/release-98/gtf/gallus_gallus/Gallus_gallus.GRCg6a.98.gtf.gz"
 params.transcript_to_gene = ""
 params.whitelist = "data/expected_whitelist.txt"
 params.config = "data/marseq_flexi_splitter.yaml"

src/example_variant_calling.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 nextflow.enable.dsl=2
 
 /*

src/fasta_sampler.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 Channel
   .fromPath( "data/tiny_dataset/fasta/*.fasta" )
   .set { fasta_file }

src/in2p3.pbs

-#! /usr/local/bin/bash -l
-#####################################
-# job script example with GE options
-#####################################
-#$ -q demon
-#$ -l demon=1
-#$ -P P_lbmc
-#$ -N nf_pipe
-#$ -o /sps/lbmc/lmodolo/logs/ # change to your username !
-#$ -e /sps/lbmc/lmodolo/logs/ # change to your username !
-#$ -r n       # relaunch y/n
-#$ -M laurent.modolo@ens-lyon.fr # change to your mail !
-#$ -m be      ## send an email when the job starts and ends
-#$ -l os=cl7  ## choose OS
-#$ -l sps=1   ## acces /sps directory
-#####################################
+#!/bin/sh
 
-NF_VERSION=19.10
-NF=/pbs/throng/lbmc/cl7/nextflow/${NF_VERSION}/nextflow
-# change to your username
-SCRATCH=/sps/lbmc/lmodolo/
-# change to your project / pipeline !
-PIPELINE=${SCRATCH}/nextflow/src/training_dataset.nf
-# change to your project / pipeline !
-CONFIG=${SCRATCH}/nextflow/src/training_dataset.config
+# SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+#
+# SPDX-License-Identifier: AGPL-3.0-or-later
 
-${NF} ${PIPELINE} -c ${CONFIG} -profile ccin2p3 \
---fasta "${SCRATCH}/nextflow/data/tiny_dataset/fasta/tiny_v2.fasta" \
---fastq_single "${SCRATCH}/nextflow/data/tiny_dataset/fastq/tiny2_S.fastq.gz" \
---chromosome "X" --start 5305683 --stop 5333928 -resume \
--w "${SCRATCH}"
+#SBATCH --job-name=nextflow
+
+#SBATCH --ntasks=1
+#SBATCH --output=results/nextflow_%j.log
+#SBATCH --licenses=sps
+
+####################################
+
+# change to your path 
+SCRATCH=/sps/lbmc/lmodolo/nextflow
+
+${SCRATCH}/nextflow run ${SCRATCH}/src/solution_RNASeq.nf -profile ccin2p3 \
+--fastq "${SCRATCH}/data/tiny_dataset/fastq/*_R{1,2}.fastq" \
+--fasta "${SCRATCH}/data/tiny_dataset/fasta/tiny_v2.fasta" \
+--bed "${SCRATCH}/data/tiny_dataset/annot/tiny.bed" \
+-ansi-log \
+-w "${SCRATCH}/work/"
+
+wait

src/install_nextflow.sh

 #!/bin/sh
 
+# SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+#
+# SPDX-License-Identifier: AGPL-3.0-or-later
+
 java -version
 curl -s https://get.nextflow.io | bash

src/nextflow.config

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 nextflowVersion = '>=20'
 
 manifest {
@@ -35,6 +39,28 @@ profiles {
       }
     }
   }
+  podman {
+    charliecloud.enabled = true
+    charliecloud.cacheDir = "./bin/"
+    process {
+      errorStrategy = 'finish'
+      memory = '16GB'
+      withLabel: big_mem_mono_cpus {
+        cpus = 1
+      }
+      withLabel: big_mem_multi_cpus {
+        cpus = 4
+      }
+      withLabel: small_mem_mono_cpus {
+        cpus = 1
+        memory = '2GB'
+      }
+      withLabel: small_mem_multi_cpus {
+        cpus = 4
+        memory = '2GB'
+      }
+    }
+  }
   singularity {
     singularity.enabled = true
     singularity.cacheDir = "./bin/"
@@ -58,98 +84,82 @@ profiles {
     }
   }
   psmn {
-    singularity.enabled = true
-    singularity.cacheDir = "/Xnfs/abc/singularity/"
-    singularity.runOptions = "--bind /Xnfs,/scratch"
+    charliecloud.enabled = true
+    charliecloud.cacheDir = "/Xnfs/abc/charliecloud"
+    charliecloud.runOptions = "--bind /scratch:/scratch --bind /Xnfs:/Xnfs --bind /home:/home"
+    charliecloud.readOnlyInputs = true
     process{
       errorStrategy = { sleep(Math.pow(2, task.attempt) * 200 as long); return 'retry' }
       maxRetries = 3
+      executor = "slurm"
+      queue = "Lake"
       withLabel: big_mem_mono_cpus {
-        executor = "sge"
-        clusterOptions = "-cwd -V"
         cpus = 1
         memory = "128GB"
-        time = "12h"
-        queue = "monointeldeb128,monointeldeb192"
+        time = "24h"
       }
       withLabel: big_mem_multi_cpus {
-        executor = "sge"
-        clusterOptions = "-cwd -V"
         cpus = 32
         memory = "192GB"
         time = "24h"
-        queue = "CLG*,SLG*,Epyc*"
-        penv = "openmp32"
-
       }
       withLabel: small_mem_mono_cpus {
-        executor = "sge"
-        clusterOptions = "-cwd -V"
         cpus = 1
         memory = "16GB"
-        time = "12h"
-        queue = "monointeldeb128,monointeldeb192"
+        time = "24h"
       }
       withLabel: small_mem_multi_cpus {
-        executor = "sge"
-        clusterOptions = "-cwd -V"
         cpus = 32
         memory = "16GB"
         time = "24h"
-        queue = "CLG*,SLG*,Epyc*"
-        penv = "openmp32"
-
       }
     }
   }
   ccin2p3 {
     singularity.enabled = true
-    singularity.cacheDir = "$baseDir/.singularity_in2p3/"
-    singularity.runOptions = "--bind /pbs,/sps,/scratch"
+    singularity.cacheDir = "$baseDir/../bin/"
+    singularity.runOptions = "--bind /pbs,/sps,/scratch,/tmp"
     process{
-      errorStrategy = { sleep(Math.pow(2, task.attempt) * 200 as long); return 'retry' }
       maxRetries = 3
       withLabel: big_mem_mono_cpus {
         scratch = true
         stageInMode = "copy"
         stageOutMode = "rsync"
-        executor = "sge"
-        clusterOptions = "-P P_lbmc -l os=cl7 -l sps=1 -r n"
+        executor = "slurm"
+        clusterOptions = "--licenses=sps"
         cpus = 1
         memory = "8GB"
-        queue = "huge"
+        queue = "htc"
       }
       withLabel: big_mem_multi_cpus {
-        container = "lbmc/urqt:d62c1f8"
         scratch = true
         stageInMode = "copy"
         stageOutMode = "rsync"
-        executor = "sge"
-        clusterOptions = "-P P_lbmc -l os=cl7 -l sps=1 -r n"
+        executor = "slurm"
+        clusterOptions = "--licenses=sps"
         cpus = 1
         memory = "8GB"
-        queue = "huge"
+        queue = "htc"
       }
       withLabel: small_mem_mono_cpus {
         scratch = true
         stageInMode = "copy"
         stageOutMode = "rsync"
-        executor = "sge"
-        clusterOptions = "-P P_lbmc -l os=cl7 -l sps=1 -r n"
+        executor = "slurm"
+        clusterOptions = "--licenses=sps"
         cpus = 1
         memory = "8GB"
-        queue = "huge"
+        queue = "htc"
       }
       withLabel: small_mem_multi_cpus {
-        container = "lbmc/urqt:d62c1f8"
         scratch = true
         stageInMode = "copy"
         stageOutMode = "rsync"
-        executor = "sge"
-        clusterOptions = "-P P_lbmc -l os=cl7 -l sps=1 -r n"
+        executor = "slurm"
+        clusterOptions = "--licenses=sps"
         cpus = 1
         memory = "8GB"
-        queue = "huge"
+        queue = "htc"
       }
     }
   }

src/nf_modules/agat/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.8.0"
+container_url = "lbmc/agat:${version}"
+
+params.gff_to_bed = ""
+params.gff_to_bed_out = ""
+process gff_to_bed {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.gff_to_bed_out != "") {
+    publishDir "results/${params.gff_to_bed_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(gff)
+  output:
+    tuple val(file_id), path("*.bed"), emit: bed
+
+  script:
+"""
+zcat ${gff} > ${gff.baseName}.gff
+agat_convert_sp_gff2bed.pl ${params.gff_to_bed} --gff ${gff.baseName}.gff -o ${gff.simpleName}.bed
+"""
+}
+
+params.gff_to_gtf = ""
+params.gff_to_gtf_out = ""
+process gff_to_gtf {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.gff_to_gtf_out != "") {
+    publishDir "results/${params.gff_to_gtf_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(gff)
+  output:
+    tuple val(file_id), path("*.gtf"), emit: gtf
+
+  script:
+"""
+zcat ${gff} > ${gff.baseName}.gff
+agat_convert_sp_gff2gtf.pl ${params.gff_to_gtf} --gff ${gff.baseName}.gff -o ${gff.simpleName}.gtf
+"""
+}
\ No newline at end of file

src/nf_modules/alntools/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 version = "dd96682"
 container_url = "lbmc/alntools:${version}"
 
@@ -17,13 +21,19 @@ process bam2ec {
 
   output:
     tuple val(file_id), path("${bam.simpleName}.bin"), emit: bin
-    tuple val(gtf_id), path("${transcripts_lengths}"), emit: tsv
+    tuple val(transcripts_lengths_id), path("${transcripts_lengths}"), emit: tsv
+    tuple val(file_id), path("${bam.simpleName}_bam2ec_report.txt"), emit: report
 
   script:
 """
-cp ${bam} file_bam.bam
-cp ${bam_idx} file_bam.bam.bai
-alntools bam2ec ${params.bam2ec} -t ${transcripts_lengths} file_bam.bam ${bam.simpleName}.bin
+mkdir tmp
+alntools bam2ec \
+  -c 1 ${params.bam2ec} \
+  -d ./tmp \
+  -t ${transcripts_lengths} \
+  -v \
+  ${bam} ${bam.simpleName}.bin &> \
+  ${bam.simpleName}_bam2ec_report.txt
 """
 }
 

src/nf_modules/beagle/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 version = "5.1_24Aug19.3e8--hdfd78af_1"
 container_url = "quay.io/biocontainers/beagle::${version}"
 

src/nf_modules/bedtools/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 version = "2.25.0"
 container_url = "lbmc/bedtools:${version}"
 
@@ -109,13 +113,13 @@ process bam_to_bedgraph {
   tuple val(bam_id), path(bam)
 
   output:
-  tuple val(bam_id), path("*.bg"), emit: bedgraph
+  tuple val(bam_id), path("*.bed"), emit: bed
 
   script:
 """
 bedtools genomecov \
   ${params.bam_to_bedgraph} \
   -ibam ${bam} \
-  -bg > ${bam.simpleName}.bg
+  -bg > ${bam.simpleName}.bed
 """
 }

src/nf_modules/bioawk/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 version = "1.0"
 container_url = "lbmc/bioawk:${version}"
 
@@ -19,6 +23,6 @@ process fasta_to_transcripts_lengths {
 
   script:
 """
-bioawk -c fastx '{print \$name length(\$seq)}' ${fasta} > ${fasta.simpleName}_transcripts_lengths.tsv
+bioawk -c fastx '{print(\$name" "length(\$seq))}' ${fasta} > ${fasta.simpleName}_transcripts_lengths.tsv
 """
 }
\ No newline at end of file

src/nf_modules/bioconvert/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.4.0"
+container_url = "lbmc/bioconvert:${version}"
+params.bigwig_to_wig = ""
+params.bigwig_to_wig_out = ""
+process bigwig_to_wig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "${file_id}"
+  if (params.bigwig_to_wig_out != "") {
+    publishDir "results/${params.bigwig_to_wig_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id) path(bw)
+
+  output:
+  tuple val(file_id), path("*.wig"), emit: wig
+
+  script:
+"""
+bioconvert bigwig2wiggle ${bw} ${bw.simpleName}.wig
+"""
+}
+
+params.bigwig2_to_wig2 = ""
+params.bigwig2_to_wig2_out = ""
+process bigwig2_to_wig2 {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "${file_id}"
+  if (params.bigwig_to_wig_out != "") {
+    publishDir "results/${params.bigwig_to_wig_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(bw_a), path(bw_b)
+
+  output:
+  tuple val(file_id), path("${bw_a.simpleName}.wig"), path("${bw_b.simpleName}.wig"), emit: wig
+
+  script:
+"""
+bioconvert bigwig2wiggle ${bw_a} ${bw_a.simpleName}.wig
+bioconvert bigwig2wiggle ${bw_b} ${bw_b.simpleName}.wig
+"""
+}
\ No newline at end of file

src/nf_modules/bowtie/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 version = "1.2.2"
 container_url = "lbmc/bowtie:${version}"
 

src/nf_modules/bowtie2/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 version = "2.3.4.1"
 container_url = "lbmc/bowtie2:${version}"
 
@@ -15,17 +19,17 @@ process index_fasta {
     tuple val(file_id), path(fasta)
 
   output:
-    tuple val(file_id), path("*.index*"), emit: index
+    tuple val(file_id), path("*.bt2"), emit: index
     tuple val(file_id), path("*_report.txt"), emit: report
 
   script:
 """
 bowtie2-build --threads ${task.cpus} \
   ${fasta} \
-  ${fasta.baseName}.index &> \
-  ${fasta.baseName}_bowtie2_index_report.txt
+  ${fasta.simpleName} &> \
+  ${fasta.simpleName}_bowtie2_index_report.txt
 
-if grep -q "Error" ${fasta.baseName}_bowtie2_index_report.txt; then
+if grep -q "Error" ${fasta.simpleName}_bowtie2_index_report.txt; then
   exit 1
 fi
 """

src/nf_modules/bwa/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 version = "0.7.17"
 container_url = "lbmc/bwa:${version}"
 

src/nf_modules/cellphonedb/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "3.0.0"
+container_url = "mlepetit/cellphonedb:latest"
+
+params.cellphonedb = ""
+params.cellphonedb_out = ""
+params.pval=""
+params.thres=""
+params.iterations=""
+params.gene_id=""
+
+
+
+workflow cellphone_statistical_analysis {
+  take:
+    meta
+    counts
+
+  main:
+
+cpdb_methods_stats(meta,counts)
+cpdb_plot_dot_plot(cpdb_methods_stats.out.means,cpdb_methods_stats.out.pvalues)
+cpdb_plot_heatmap(cpdb_methods_stats.out.pvalues)
+
+
+  emit:
+    means = cpdb_methods_stats.out.means
+    pvalues = cpdb_methods_stats.out.pvalues
+    deconvoluted = cpdb_methods_stats.out.deconvoluted
+    significant_means = cpdb_methods_stats.out.significant_means
+    dot_plot = cpdb_plot_dot_plot.out.dot_plot
+    heatmap = cpdb_plot_heatmap.out.heatmap
+    heatmap_log = cpdb_plot_heatmap.out.heatmap_log
+    count_network = cpdb_plot_heatmap.out.count_network
+    interactions_count = cpdb_plot_heatmap.out.interactions_count
+
+
+}
+
+
+
+
+
+
+
+
+
+
+process cpdb_methods_stats {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+    if (params.cellphonedb_out != "") {
+    publishDir "results/${params.cellphonedb_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(id_mtx), path(meta)
+    tuple val(id_mtx), path(counts)
+  
+  output:
+   tuple val(id_mtx), path("out/means.txt"), emit: means
+   tuple val(id_mtx), path("out/pvalues.txt"), emit: pvalues
+   tuple val(id_mtx), path("out/deconvoluted.txt"), emit: deconvoluted
+   tuple val(id_mtx), path("out/significant_means.txt"), emit: significant_means
+  
+script:
+  """
+cellphonedb method statistical_analysis ${params.meta} ${params.counts} --counts-data ${params.gene_id}  --threads ${task.cpus} --iterations ${params.iterations} --pvalue ${params.pval} --threshold ${params.thres}
+
+  """
+}
+
+
+process cpdb_plot_dot_plot {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+    if (params.cellphonedb_out != "") {
+    publishDir "results/${params.cellphonedb_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(id_mtx), path(means)
+    tuple val(id_mtx), path(pvalues)
+
+  output:
+   tuple val(id_mtx), path("out/plot.pdf"), emit: dot_plot
+
+script:
+  """
+mkdir ./out
+cellphonedb plot dot_plot --means-path ${means} --pvalues-path ${pvalues} 
+
+  """
+}
+ 
+process cpdb_plot_heatmap {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+    if (params.cellphonedb_out != "") {
+    publishDir "results/${params.cellphonedb_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(id_mtx), path(pvalues)
+
+  output:
+   tuple val(id_mtx), path("out/heatmap_count.pdf"), emit: heatmap
+ tuple val(id_mtx), path("out/heatmap_log_count.pdf"), emit: heatmap_log
+ tuple val(id_mtx), path("out/count_network.txt"), emit: count_network
+ tuple val(id_mtx), path("out/interaction_count.txt"), emit: interactions_count
+
+script:
+ 
+ """
+mkdir ./out
+cellphonedb plot heatmap_plot --pvalues-path ${pvalues} --pvalue ${params.pval} ${params.meta}
+
+  """
+}

src/nf_modules/cutadapt/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 version = "2.1"
 container_url = "lbmc/cutadapt:${version}"
 
@@ -77,3 +81,26 @@ process trimming {
   ${reads} > ${file_prefix}_report.txt
   """
 }
+
+
+process 5pRACE {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"tag "$file_id"
+  
+  if (params.cutadapt_out != "") {
+    publishDir "results/${params.cutadapt_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(fastq)
+
+  output:
+  tuple val(file_id), path("*_cut_*"), emit: fastq
+
+  """
+  cutadapt -e 0.2 -g CGACTGGAGCACGAGGACACTGACATGGACTGAAGGAGTAGAAA -g TTAGGCAGAGGTGAAAAAGTTG 
+                  -a TTTCTACTCCTTCAGTCCATGTCAGTGTCCTCGTGCTCCAGTCG -a CAACTTTTTCACCTCTGCCTAA 
+                  -o ${}
+                  ${fastq}
+  """
+}
\ No newline at end of file

src/nf_modules/danpos/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "v2.2.2_cv3"
+container_url = "biocontainers/danpos:${version}"
+
+include {
+  bigwig2_to_wig2;
+  bigwig_to_wig;
+  wig_to_bedgraph;
+  wig2_to_bedgraph2
+} from "./../ucsc/main.nf"
+
+params.dpos = "--smooth_width 0 -n N "
+params.dpos_out = ""
+
+workflow dpos_bam_bg {
+  take:
+    fasta
+    fastq
+    bam
+
+  main:
+    dpos_bam(fastq, bam)
+    wig2_to_bedgraph2(fasta, dpos_bam.out.wig)
+
+  emit:
+    bg = wig2_to_bedgraph2.out.bg
+    wig = dpos_bam.out.wig
+    bed = dpos_bam.out.bed
+}
+
+process dpos_bam {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(bam_ip), path(bam_wce)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/${bam_ip.simpleName}*.wig"), path("${file_prefix}/${bam_wce.simpleName}*.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -b ${bam_wce} \
+  -o ${file_prefix} \
+  ${bam_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.bed
+"""
+}
+
+workflow dpos_bw {
+  take:
+    fasta
+    fastq
+    bw
+  main:
+    bigwig2_to_wig2(bw)
+    dpos_wig(fastq, bigwig2_to_wig2.out.wig)
+    wig_to_bedgraph(fasta, bigwig2_to_wig2.out.wig)
+
+  emit:
+  bg = wig_to_bedgraph.out.bg
+  wig = bigwig2_to_wig2.out.wig
+  bed = dpos_wig.out.bed
+}
+
+process dpos_wig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(wig_ip), path(wig_wce)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+    tuple val(file_id), path("${file_prefix}/${bam_ip.simpleName}*.wig"), path("${file_prefix}/${bam_wce.simpleName}*.wig"), emit: wig
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -b ${wig_wce} \
+  -o ${file_prefix} \
+  ${wig_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.positions.xls > ${file_prefix}/${wig_ip.simpleName}.positions.bed
+"""
+}
+
+workflow dpos_bw_no_b {
+  take:
+    fasta
+    fastq
+    bw
+  main:
+    bigwig_to_wig(bw)
+    dpos_wig_no_b(fastq, bigwig_to_wig.out.wig)
+    wig_to_bedgraph(fasta, bigwig_to_wig.out.wig)
+
+  emit:
+  bg = wig_to_bedgraph.out.bg
+  wig = bigwig_to_wig.out.wig
+  bed = dpos_wig_no_b.out.bed
+}
+
+process dpos_wig_no_b {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(wig_ip)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -o ${file_prefix} \
+  ${wig_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.positions.xls > ${file_prefix}/${wig_ip.simpleName}.positions.bed
+"""
+}
+
+workflow dwig_bwvsbw {
+  take:
+    fasta
+    fastq
+    bw_a
+    bw_b
+  main:
+    dpos_wigvswig(
+      fastq,
+      bigwig2_to_wig2(bw_a),
+      bigwig2_to_wig2(bw_b),
+    )
+    wig_to_bedgraph(fasta, dpos_wigvswig.out.wig)
+
+  emit:
+  bg = wig_to_bedgraph.out.bg
+  wig = dpeak_wig.out.wig
+  bed = dpeak_wig.out.bed
+}
+
+process dpos_wigvswig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id_a), path(wig_ip_a)
+    tuple val(file_id_b), path(wig_ip_b)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/${wig_ip_a.simpleName}*.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+
+  script:
+
+  switch(file_id_a) {
+    case {it instanceof List}:
+      file_prefix = file_id_a[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id_a.values()[0]
+    break
+    default:
+      file_prefix = file_id_a
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -b ${wig_ip_a},${wig_ip_b} \
+  -o ${file_prefix} \
+  ${wig_ip_a}:${wig_ip_b}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.positions.xls > ${file_prefix}/${bam_ip.simpleName}.positions.bed
+"""
+}
+
+params.dpeak = "--smooth_width 0 -n N "
+params.dpeak_out = ""
+
+process dpeak_bam {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpeak_out != "") {
+    publishDir "results/${params.dpeak_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(bam_ip), path(bam_wce)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/${bam_ip.simpleName}*.wig"), path("${file_prefix}/${bam_wce.simpleName}*.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), path("${file_prefix}/*.summit.bed"), emit: bed
+    tuple val(file_id), path("${file_prefix}/*.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpeak -m ${m} \
+  ${params.dpeak} \
+  -b ${bam_wce} \
+  -o ${file_prefix} \
+  ${bam_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.bed
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$4-1, \$4, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.summit.bed
+"""
+}
+
+workflow dpeak_bw {
+  take:
+    fasta
+    fastq
+    bw
+  main:
+    dpeak_wig(fastq, bigwig2_to_wig2(bw))
+    wig2_to_bedgraph2(fasta, dpeak_wig.out.wig)
+
+  emit:
+  bg = wig2_to_bedgraph2.out.bg
+  wig = dpeak_wig.out.wig
+  bed = dpeak_wig.out.bed
+}
+
+
+process dpeak_wig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpeak_out != "") {
+    publishDir "results/${params.dpeak_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(wig_ip), path(wig_wce)
+
+  output:
+  tuple val(file_id), path("${file_prefix}/${wig_ip.simpleName}.bgsub.wig"), path("${file_prefix}/${wig_wce.simpleName}.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), path("${file_prefix}/*.summit.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpeak -m ${m} \
+  ${params.dpeak} \
+  -b ${wig_wce} \
+  -o ${file_prefix} \
+  ${wig_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${wig_ip.simpleName}.bgsub.positions.bed
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$4-1, \$4, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${wig_ip.simpleName}.bgsub.positions.summit.bed
+"""
+}
+
+workflow dpeak_bwvsbw {
+  take:
+    fasta
+    fastq
+    bw_a
+    bw_b
+  main:
+    dpeak_wigvswig(
+      fastq,
+      bigwig2_to_wig2(bw_a),
+      bigwig2_to_wig2(bw_b),
+    )
+    wig2_to_bedgraph2(fasta, dpeak_wigvswig.out.wig)
+
+  emit:
+  bg = wig2_to_bedgraph2.out.bg
+  wig = dpeak_wig.out.wig
+  bed = dpeak_wig.out.bed
+}
+
+
+process dpeak_wigvswig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpeak_out != "") {
+    publishDir "results/${params.dpeak_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id_a), path(wig_ip_a), path(wig_wce_a)
+    tuple val(file_id_b), path(wig_ip_b), path(wig_wce_b)
+
+  output:
+  tuple val(file_id), path("${file_prefix}/${wig_ip_a.simpleName}.bgsub.wig"), path("${file_prefix}/${wig_wce_a.simpleName}.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), path("${file_prefix}/*.summit.bed"), emit: bed
+
+  script:
+
+  switch(file_id_a) {
+    case {it instanceof List}:
+      file_prefix = file_id_a[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id_a.values()[0]
+    break
+    default:
+      file_prefix = file_id_a
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpeak -m ${m} \
+  ${params.dpeak} \
+  -b ${wig_ip_a}:${wig_wce_a},${wig_ip_b}:${wig_wce_b} \
+  -o ${file_prefix} \
+  ${wig_ip_a}:${wig_ip_b}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.bed
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$4-1, \$4, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.summit.bed
+"""
+}
\ No newline at end of file

src/nf_modules/deeptools/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
 version = "3.5.1"
 container_url = "lbmc/deeptools:${version}"