src/nf_modules/SRAtoolkit/2.8.2/docker_init.sh

-#!/bin/sh
-docker build src/nf_modules/SRAtoolkit/2.8.2 -t 'sratoolkit:2.8.2'

src/nf_modules/Salmon/0.8.2/docker_init.sh

-#!/bin/sh
-docker build src/nf_modules/Salmon/0.8.2 -t 'salmon:0.8.2'

src/nf_modules/TopHat/2.1.1/Dockerfile

-FROM ubuntu:18.04
-MAINTAINER Laurent Modolo
-
-ENV TOPHAT_VERSION=2.1.1
-ENV PACKAGES tophat=${BOWTIE2_VERSION}*
-
-RUN apt-get update && \
-    apt-get install -y --no-install-recommends ${PACKAGES} && \
-    apt-get clean

src/nf_modules/TopHat/2.1.1/docker_init.sh

-#!/bin/sh
-docker build src/nf_modules/TopHat/2.1.1 -t 'tophat:2.1.1'

src/nf_modules/Trimmomatic/0.36/docker_init.sh

-#!/bin/sh
-docker build src/nf_modules/Trimmomatic/0.36 -t 'trimmomatic:0.36'

src/nf_modules/UrQt/d62c1f8/docker_init.sh

-#!/bin/sh
-docker build src/nf_modules/UrQt/d62c1f8 -t 'urqt:62c1f8'

src/nf_modules/agat/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.8.0"
+container_url = "lbmc/agat:${version}"
+
+params.gff_to_bed = ""
+params.gff_to_bed_out = ""
+process gff_to_bed {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.gff_to_bed_out != "") {
+    publishDir "results/${params.gff_to_bed_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(gff)
+  output:
+    tuple val(file_id), path("*.bed"), emit: bed
+
+  script:
+"""
+zcat ${gff} > ${gff.baseName}.gff
+agat_convert_sp_gff2bed.pl ${params.gff_to_bed} --gff ${gff.baseName}.gff -o ${gff.simpleName}.bed
+"""
+}
+
+params.gff_to_gtf = ""
+params.gff_to_gtf_out = ""
+process gff_to_gtf {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.gff_to_gtf_out != "") {
+    publishDir "results/${params.gff_to_gtf_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(gff)
+  output:
+    tuple val(file_id), path("*.gtf"), emit: gtf
+
+  script:
+"""
+zcat ${gff} > ${gff.baseName}.gff
+agat_convert_sp_gff2gtf.pl ${params.gff_to_gtf} --gff ${gff.baseName}.gff -o ${gff.simpleName}.gtf
+"""
+}
\ No newline at end of file

src/nf_modules/alntools/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "dd96682"
+container_url = "lbmc/alntools:${version}"
+
+params.bam2ec = ""
+params.bam2ec_out = ""
+process bam2ec {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.bam2ec_out != "") {
+    publishDir "results/${params.bam2ec_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(bam), path(bam_idx)
+    tuple val(transcripts_lengths_id), path(transcripts_lengths)
+
+  output:
+    tuple val(file_id), path("${bam.simpleName}.bin"), emit: bin
+    tuple val(transcripts_lengths_id), path("${transcripts_lengths}"), emit: tsv
+    tuple val(file_id), path("${bam.simpleName}_bam2ec_report.txt"), emit: report
+
+  script:
+"""
+mkdir tmp
+alntools bam2ec \
+  -c 1 ${params.bam2ec} \
+  -d ./tmp \
+  -t ${transcripts_lengths} \
+  -v \
+  ${bam} ${bam.simpleName}.bin &> \
+  ${bam.simpleName}_bam2ec_report.txt
+"""
+}
+
+params.gtf_to_transcripts_lengths = ""
+params.gtf_to_transcripts_lengths_out = ""
+process gtf_to_transcripts_lengths {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.gtf_to_transcripts_lengths != "") {
+    publishDir "results/${params.gtf_to_transcripts_lengths}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(gtf)
+
+  output:
+    tuple val(file_id), path("${gtf.simpleName}_transcripts_lengths.tsv"), emit: tsv
+
+  script:
+"""
+awk -F"[\\t;]" '
+\$3=="exon" {
+        ID=gensub(/transcript_id \\"(.*)\\"/, "\\\\1", "g", \$11); 
+        LEN[ID]+=\$5-\$4+1;
+    } 
+END{
+    for(i in LEN)
+        {print i"\\t"LEN[i]}
+    }
+' ${gtf} > ${gtf.simpleName}_transcripts_lengths.tsv
+"""
+}

src/nf_modules/beagle/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "5.1_24Aug19.3e8--hdfd78af_1"
+container_url = "quay.io/biocontainers/beagle::${version}"
+
+params.phasing = ""
+process phasing {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+
+  input:
+    tuple val(file_id), path(vcf)
+    tuple val(ref_id), path(ref_vcf)
+
+  output:
+    tuple val(file_id), path("*.bam*"), emit: bam
+
+  script:
+"""
+beagle nthread=${task.cpus} \
+  gtgl=${vcf} \
+  ref=${ref_vcf}
+"""
+}

src/nf_modules/bedtools/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "2.25.0"
+container_url = "lbmc/bedtools:${version}"
+
+params.fasta_from_bed = "-name"
+params.fasta_from_bed_out = ""
+process fasta_from_bed {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "${file_id}"
+  if (params.fasta_from_bed_out != "") {
+    publishDir "results/${params.fasta_from_bed_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(fasta_id), path(fasta)
+  tuple val(file_id), path(bed)
+
+  output:
+  tuple val(file_id), path("*_extracted.fasta"), emit: fasta
+
+  script:
+"""
+bedtools getfasta ${params.fasta_from_bed} \
+-fi ${fasta} -bed ${bed} -fo ${bed.baseName}_extracted.fasta
+"""
+}
+
+params.merge_bed = ""
+params.merge_bed_out = ""
+process merge_bed {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "${file_id}"
+  if (params.merge_bed_out != "") {
+    publishDir "results/${params.merge_bed_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(bed)
+
+  output:
+  tuple val(file_id), path("*_merged.fasta"), emit: bed
+
+  script:
+"""
+bedtools merge ${params.merge_bed} -i ${bed} > ${bed[0].simpleName}_merged.bed
+"""
+}
+
+params.bam_to_fastq_singleend = ""
+params.bam_to_fastq_singleend_out = ""
+process bam_to_fastq_singleend {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "${bam_id}"
+  if (params.bam_to_fastq_singleend_out != "") {
+    publishDir "results/${params.bam_to_fastq_singleend_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(bam_id), path(bam)
+
+  output:
+  tuple val(bam_id), path("*.fastq"), emit: fastq
+
+  script:
+"""
+bedtools bamtofastq \
+  ${params.bam_to_fastq_singleend} \
+  -i ${bam} -fq ${bam.baseName}.fastq
+"""
+}
+
+params.bam_to_fastq_pairedend = ""
+params.bam_to_fastq_pairedend_out = ""
+process bam_to_fastq_pairedend {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "${bam_id}"
+  if (params.bam_to_fastq_pairedend_out != "") {
+    publishDir "results/${params.bam_to_fastq_pairedend_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(bam_id), path(bam)
+
+  output:
+  tuple val(bam_id), path("*.fastq"), emit: fastq
+
+  script:
+"""
+bedtools bamtofastq \
+  ${params.bam_to_fastq_pairedend} \
+  -i ${bam} -fq ${bam.baseName}_R1.fastq -fq2 ${bam.baseName}_R2.fastq
+"""
+}
+
+params.bam_to_bedgraph = ""
+params.bam_to_bedgraph_out = ""
+process bam_to_bedgraph {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "${bam_id}"
+  if (params.bam_to_bedgraph_out != "") {
+    publishDir "results/${params.bam_to_bedgraph_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(bam_id), path(bam)
+
+  output:
+  tuple val(bam_id), path("*.bed"), emit: bed
+
+  script:
+"""
+bedtools genomecov \
+  ${params.bam_to_bedgraph} \
+  -ibam ${bam} \
+  -bg > ${bam.simpleName}.bed
+"""
+}

src/nf_modules/bioawk/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "1.0"
+container_url = "lbmc/bioawk:${version}"
+
+params.fasta_to_transcripts_lengths = ""
+params.fasta_to_transcripts_lengths_out = ""
+process fasta_to_transcripts_lengths {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.fasta_to_transcripts_lengths_out != "") {
+    publishDir "results/${params.fasta_to_transcripts_lengths_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(fasta)
+
+  output:
+    tuple val(file_id), path("${fasta.simpleName}_transcripts_lengths.tsv"), emit: tsv
+
+  script:
+"""
+bioawk -c fastx '{print(\$name" "length(\$seq))}' ${fasta} > ${fasta.simpleName}_transcripts_lengths.tsv
+"""
+}
\ No newline at end of file

src/nf_modules/bioconvert/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.4.0"
+container_url = "lbmc/bioconvert:${version}"
+params.bigwig_to_wig = ""
+params.bigwig_to_wig_out = ""
+process bigwig_to_wig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "${file_id}"
+  if (params.bigwig_to_wig_out != "") {
+    publishDir "results/${params.bigwig_to_wig_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id) path(bw)
+
+  output:
+  tuple val(file_id), path("*.wig"), emit: wig
+
+  script:
+"""
+bioconvert bigwig2wiggle ${bw} ${bw.simpleName}.wig
+"""
+}
+
+params.bigwig2_to_wig2 = ""
+params.bigwig2_to_wig2_out = ""
+process bigwig2_to_wig2 {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "${file_id}"
+  if (params.bigwig_to_wig_out != "") {
+    publishDir "results/${params.bigwig_to_wig_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(bw_a), path(bw_b)
+
+  output:
+  tuple val(file_id), path("${bw_a.simpleName}.wig"), path("${bw_b.simpleName}.wig"), emit: wig
+
+  script:
+"""
+bioconvert bigwig2wiggle ${bw_a} ${bw_a.simpleName}.wig
+bioconvert bigwig2wiggle ${bw_b} ${bw_b.simpleName}.wig
+"""
+}
\ No newline at end of file

src/nf_modules/bowtie/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "1.2.2"
+container_url = "lbmc/bowtie:${version}"
+
+params.index_fasta = ""
+params.index_fasta_out = ""
+process index_fasta {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.index_fasta_out != "") {
+    publishDir "results/${params.index_fasta_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(fasta)
+
+  output:
+    tuple val(file_id), path("*.index*"), emit: index
+    tuple val(file_id), path("*_report.txt"), emit: report
+
+  script:
+"""
+bowtie-build --threads ${task.cpus} \
+  ${params.index_fasta} \
+  -f ${fasta} ${fasta.baseName}.index &> \
+  ${fasta.baseName}_bowtie_index_report.txt
+
+if grep -q "Error" ${fasta.baseName}_bowtie_index_report.txt; then
+  exit 1
+fi
+"""
+}
+
+params.mapping_fastq = "--very-sensitive"
+params.mapping_fastq_out = ""
+process mapping_fastq {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$pair_id"
+  if (params.mapping_fastq_out != "") {
+    publishDir "results/${params.mapping_fastq_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(index_id), path(index)
+  tuple val(file_id), path(reads)
+
+  output:
+  tuple val(file_id), path("*.bam"), emit: bam
+  path "*_report.txt", emit: report
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+  index_id = index[0]
+  for (index_file in index) {
+    if (index_file =~ /.*\.1\.bt2/ && !(index_file =~ /.*\.rev\.1\.bt2/)) {
+        index_id = ( index_file =~ /(.*)\.1\.bt2/)[0][1]
+    }
+  }
+  if (reads.size() == 2)
+  """
+  # -v specify the max number of missmatch, -k the number of match reported per
+  # reads
+  bowtie --best -v 3 -k 1 --sam -p ${task.cpus} ${index_id} \
+    ${params.mapping_fastq} \
+    -1 ${reads[0]} -2 ${reads[1]} 2> \
+    ${file_id}_bowtie_report_tmp.txt | \
+    samtools view -Sb - > ${file_id}.bam
+
+  if grep -q "Error" ${file_id}_bowtie_report_tmp.txt; then
+    exit 1
+  fi
+  tail -n 19 ${file_id}_bowtie_report_tmp.txt > \
+    ${file_id}_bowtie_mapping_report.txt
+  """
+  else
+  """
+  bowtie --best -v 3 -k 1 --sam -p ${task.cpus} ${index_id} \
+    ${params.mapping_fastq}
+    -q ${reads} 2> \
+    ${file_id}_bowtie_report_tmp.txt | \
+    samtools view -Sb - > ${file_id}.bam
+
+  if grep -q "Error" ${file_id}_bowtie_report_tmp.txt; then
+    exit 1
+  fi
+  tail -n 19 ${file_id}_bowtie_report_tmp.txt > \
+    ${file_id}_bowtie_mapping_report.txt
+  """
+}
+
+params.mapping_fastq_pairedend = ""
+process mapping_fastq_pairedend {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$pair_id"
+
+  input:
+  path index
+  tuple val(pair_id), path(reads)
+
+  output:
+  tuple val(pair_id), path("*.bam"), emit: bam
+  path "*_report.txt", emit: report
+
+  script:
+  index_id = index[0]
+  for (index_file in index) {
+    if (index_file =~ /.*\.1\.bt2/ && !(index_file =~ /.*\.rev\.1\.bt2/)) {
+        index_id = ( index_file =~ /(.*)\.1\.bt2/)[0][1]
+    }
+  }
+"""
+# -v specify the max number of missmatch, -k the number of match reported per
+# reads
+bowtie --best -v 3 -k 1 --sam -p ${task.cpus} ${index_id} \
+  ${params.mapping_fastq_pairedend} \
+  -1 ${reads[0]} -2 ${reads[1]} 2> \
+  ${pair_id}_bowtie_report_tmp.txt | \
+  samtools view -Sb - > ${pair_id}.bam
+
+if grep -q "Error" ${pair_id}_bowtie_report_tmp.txt; then
+  exit 1
+fi
+tail -n 19 ${pair_id}_bowtie_report_tmp.txt > \
+  ${pair_id}_bowtie_mapping_report.txt
+"""
+}
+
+params.mapping_fastq_singleend = ""
+process mapping_fastq_singleend {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+
+  input:
+  path index
+  tuple val(file_id), path(reads)
+
+  output:
+  set file_id, "*.bam", emit: bam
+  file "*_report.txt", emit: report
+
+  script:
+  index_id = index[0]
+  for (index_file in index) {
+    if (index_file =~ /.*\.1\.bt2/ && !(index_file =~ /.*\.rev\.1\.bt2/)) {
+        index_id = ( index_file =~ /(.*)\.1\.bt2/)[0][1]
+    }
+  }
+"""
+bowtie --best -v 3 -k 1 --sam -p ${task.cpus} ${index_id} \
+  ${params.mapping_fastq_singleend} \
+  -q ${reads} 2> \
+  ${file_id}_bowtie_report_tmp.txt | \
+  samtools view -Sb - > ${file_id}.bam
+
+if grep -q "Error" ${file_id}_bowtie_report_tmp.txt; then
+  exit 1
+fi
+tail -n 19 ${file_id}_bowtie_report_tmp.txt > \
+  ${file_id}_bowtie_mapping_report.txt
+"""
+}

src/nf_modules/bowtie2/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "2.3.4.1"
+container_url = "lbmc/bowtie2:${version}"
+
+params.index_fasta = ""
+params.index_fasta_out = ""
+process index_fasta {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.index_fasta_out != "") {
+    publishDir "results/${params.index_fasta_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(fasta)
+
+  output:
+    tuple val(file_id), path("*.bt2"), emit: index
+    tuple val(file_id), path("*_report.txt"), emit: report
+
+  script:
+"""
+bowtie2-build --threads ${task.cpus} \
+  ${fasta} \
+  ${fasta.simpleName} &> \
+  ${fasta.simpleName}_bowtie2_index_report.txt
+
+if grep -q "Error" ${fasta.simpleName}_bowtie2_index_report.txt; then
+  exit 1
+fi
+"""
+}
+
+params.mapping_fastq = "--very-sensitive"
+params.mapping_fastq_out = ""
+process mapping_fastq {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.mapping_fastq_out != "") {
+    publishDir "results/${params.mapping_fastq_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(index_id), path(index)
+  tuple val(file_id), path(reads)
+
+  output:
+  tuple val(file_id), path("*.bam"), emit: bam
+  path "*_report.txt", emit: report
+
+  script:
+  index_id = index[0]
+  for (index_file in index) {
+    if (index_file =~ /.*\.1\.bt2/ && !(index_file =~ /.*\.rev\.1\.bt2/)) {
+        index_id = ( index_file =~ /(.*)\.1\.bt2/)[0][1]
+    }
+  }
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  if (reads.size() == 2)
+  """
+  bowtie2 ${params.mapping_fastq} \
+    -p ${task.cpus} \
+    -x ${index_id} \
+    -1 ${reads[0]} \
+    -2 ${reads[1]} 2> \
+    ${file_prefix}_bowtie2_mapping_report_tmp.txt | \
+    samtools view -Sb - > ${file_prefix}.bam
+
+  if grep -q "Error" ${file_prefix}_bowtie2_mapping_report_tmp.txt; then
+    exit 1
+  fi
+  tail -n 19 ${file_prefix}_bowtie2_mapping_report_tmp.txt > \
+    ${file_prefix}_bowtie2_mapping_report.txt
+  """
+  else
+  """
+  bowtie2 ${params.mapping_fastq} \
+    -p ${task.cpus} \
+    -x ${index_id} \
+    -U ${reads} 2> \
+    ${file_prefix}_bowtie2_mapping_report_tmp.txt | \
+    samtools view -Sb - > ${file_prefix}.bam
+
+  if grep -q "Error" ${file_prefix}_bowtie2_mapping_report_tmp.txt; then
+    exit 1
+  fi
+  tail -n 19 ${file_prefix}_bowtie2_mapping_report_tmp.txt > \
+    ${file_prefix}_bowtie2_mapping_report.txt
+  """
+}

src/nf_modules/bwa/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "0.7.17"
+container_url = "lbmc/bwa:${version}"
+
+
+workflow mapping {
+  take:
+    fasta
+    fastq
+  main:
+    index_fasta(fasta)
+    mapping_fastq(index_fasta.out.index.collect(), fastq)
+  emit:
+    bam = mapping_fastq.out.bam
+    report = mapping_fastq.out.report
+}
+
+
+params.index_fasta = ""
+params.index_fasta_out = ""
+process index_fasta {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.index_fasta_out != "") {
+    publishDir "results/${params.index_fasta_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(file_id), path(fasta)
+
+  output:
+    tuple val(file_id), path("${fasta.simpleName}.*"), emit: index
+    tuple val(file_id), path("*_bwa_report.txt"), emit: report
+
+  script:
+"""
+bwa index ${params.index_fasta} -p ${fasta.simpleName} ${fasta} \
+&> ${fasta.simpleName}_bwa_report.txt
+"""
+}
+
+
+params.mapping_fastq = ""
+params.mapping_fastq_out = ""
+process mapping_fastq {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+  tag "$file_id"
+  if (params.mapping_fastq_out != "") {
+    publishDir "results/${params.mapping_fastq_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(index_id), path(index)
+  tuple val(file_id), path(reads)
+
+  output:
+  tuple val(file_id), path("*.bam"), emit: bam
+  tuple val(file_id), path("${file_prefix}_bwa_report.txt"), emit: report
+
+  script:
+  if (file_id instanceof List){
+    library = file_id[0]
+    file_prefix = file_id[0]
+  } else if (file_id instanceof Map) {
+      library = file_id[0]
+      file_prefix = file_id[0]
+      if (file_id.containsKey('library')) {
+        library = file_id.library
+        file_prefix = file_id.id
+      }
+  } else {
+    library = file_id
+    file_prefix = file_id
+  }
+bwa_mem_R = "@RG\\tID:${library}\\tSM:${library}\\tLB:lib_${library}\\tPL:illumina"
+  if (reads.size() == 2)
+"""
+bwa mem -t ${task.cpus} \
+${params.mapping_fastq} \
+-R '${bwa_mem_R}' \
+${index[0].baseName} ${reads[0]} ${reads[1]} 2> \
+  ${file_prefix}_bwa_report.txt | \
+  samtools view -@ ${task.cpus} -Sb - > ${file_prefix}.bam
+"""
+  else
+"""
+bwa mem -t ${task.cpus} \
+${params.mapping_fastq} \
+-R '${bwa_mem_R}' \
+${index[0].baseName} ${reads} 2> \
+  ${file_prefix}_bwa_report.txt | \
+  samtools view -@ ${task.cpus} -Sb - > ${file_prefix}.bam
+"""
+}
+

src/nf_modules/canu/1.6/docker_init.sh

-#!/bin/sh
-docker build src/nf_modules/canu/1.6 -t 'canu:1.6'

src/nf_modules/cellphonedb/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "3.0.0"
+container_url = "mlepetit/cellphonedb:latest"
+
+params.cellphonedb = ""
+params.cellphonedb_out = ""
+params.pval=""
+params.thres=""
+params.iterations=""
+params.gene_id=""
+
+
+
+workflow cellphone_statistical_analysis {
+  take:
+    meta
+    counts
+
+  main:
+
+cpdb_methods_stats(meta,counts)
+cpdb_plot_dot_plot(cpdb_methods_stats.out.means,cpdb_methods_stats.out.pvalues)
+cpdb_plot_heatmap(cpdb_methods_stats.out.pvalues)
+
+
+  emit:
+    means = cpdb_methods_stats.out.means
+    pvalues = cpdb_methods_stats.out.pvalues
+    deconvoluted = cpdb_methods_stats.out.deconvoluted
+    significant_means = cpdb_methods_stats.out.significant_means
+    dot_plot = cpdb_plot_dot_plot.out.dot_plot
+    heatmap = cpdb_plot_heatmap.out.heatmap
+    heatmap_log = cpdb_plot_heatmap.out.heatmap_log
+    count_network = cpdb_plot_heatmap.out.count_network
+    interactions_count = cpdb_plot_heatmap.out.interactions_count
+
+
+}
+
+
+
+
+
+
+
+
+
+
+process cpdb_methods_stats {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+    if (params.cellphonedb_out != "") {
+    publishDir "results/${params.cellphonedb_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(id_mtx), path(meta)
+    tuple val(id_mtx), path(counts)
+  
+  output:
+   tuple val(id_mtx), path("out/means.txt"), emit: means
+   tuple val(id_mtx), path("out/pvalues.txt"), emit: pvalues
+   tuple val(id_mtx), path("out/deconvoluted.txt"), emit: deconvoluted
+   tuple val(id_mtx), path("out/significant_means.txt"), emit: significant_means
+  
+script:
+  """
+cellphonedb method statistical_analysis ${params.meta} ${params.counts} --counts-data ${params.gene_id}  --threads ${task.cpus} --iterations ${params.iterations} --pvalue ${params.pval} --threshold ${params.thres}
+
+  """
+}
+
+
+process cpdb_plot_dot_plot {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+    if (params.cellphonedb_out != "") {
+    publishDir "results/${params.cellphonedb_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(id_mtx), path(means)
+    tuple val(id_mtx), path(pvalues)
+
+  output:
+   tuple val(id_mtx), path("out/plot.pdf"), emit: dot_plot
+
+script:
+  """
+mkdir ./out
+cellphonedb plot dot_plot --means-path ${means} --pvalues-path ${pvalues} 
+
+  """
+}
+ 
+process cpdb_plot_heatmap {
+  container = "${container_url}"
+  label "big_mem_multi_cpus"
+    if (params.cellphonedb_out != "") {
+    publishDir "results/${params.cellphonedb_out}", mode: 'copy'
+  }
+
+  input:
+    tuple val(id_mtx), path(pvalues)
+
+  output:
+   tuple val(id_mtx), path("out/heatmap_count.pdf"), emit: heatmap
+ tuple val(id_mtx), path("out/heatmap_log_count.pdf"), emit: heatmap_log
+ tuple val(id_mtx), path("out/count_network.txt"), emit: count_network
+ tuple val(id_mtx), path("out/interaction_count.txt"), emit: interactions_count
+
+script:
+ 
+ """
+mkdir ./out
+cellphonedb plot heatmap_plot --pvalues-path ${pvalues} --pvalue ${params.pval} ${params.meta}
+
+  """
+}

src/nf_modules/cutadapt/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "2.1"
+container_url = "lbmc/cutadapt:${version}"
+
+params.adapter_3_prim = "AGATCGGAAGAG"
+params.adapter_5_prim = "CTCTTCCGATCT"
+params.adaptor_removal = "-a ${params.adapter_3_prim} -g ${params.adapter_5_prim} -A ${params.adapter_3_prim} -G ${params.adapter_5_prim}"
+params.adaptor_removal_out = ""
+process adaptor_removal {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.adaptor_removal_out != "") {
+    publishDir "results/${params.adaptor_removal_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(reads)
+
+  output:
+  tuple val(file_id), path("*_cut_*"), emit: fastq
+  path "*_report.txt", emit: report
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+  if (reads.size() == 2)
+  """
+  cutadapt ${params.adaptor_removal} \
+  -o ${file_prefix}_cut_R1.fastq.gz -p ${file_prefix}_cut_R2.fastq.gz \
+  ${reads[0]} ${reads[1]} > ${file_prefix}_report.txt
+  """
+  else
+  """
+  cutadapt ${params.adaptor_removal} \
+  -o ${file_prefix}_cut.fastq.gz \
+  ${reads} > ${file_prefix}_report.txt
+  """
+}
+
+params.trim_quality = "20"
+params.trimming = "-q ${params.trim_quality},${params.trim_quality}"
+params.trimming_out = ""
+process trimming {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.trimming_out != "") {
+    publishDir "results/${params.trimming_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(reads)
+
+  output:
+  tuple val(file_id), path("*_trim_*"), emit:fastq
+  path "*_report.txt", emit: report
+
+  script:
+  if (file_id instanceof List){
+    file_prefix = file_id[0]
+  } else {
+    file_prefix = file_id
+  }
+  if (reads.size() == 2)
+  """
+  cutadapt ${params.trimming} \
+  -o ${file_prefix}_trim_R1.fastq.gz -p ${file_prefix}_trim_R2.fastq.gz \
+  ${reads[0]} ${reads[1]} > ${file_prefix}_report.txt
+  """
+  else
+  """
+  cutadapt ${params.trimming} \
+  -o ${file_prefix}_trim.fastq.gz \
+  ${reads} > ${file_prefix}_report.txt
+  """
+}
+
+
+process 5pRACE {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"tag "$file_id"
+  
+  if (params.cutadapt_out != "") {
+    publishDir "results/${params.cutadapt_out}", mode: 'copy'
+  }
+
+  input:
+  tuple val(file_id), path(fastq)
+
+  output:
+  tuple val(file_id), path("*_cut_*"), emit: fastq
+
+  """
+  cutadapt -e 0.2 -g CGACTGGAGCACGAGGACACTGACATGGACTGAAGGAGTAGAAA -g TTAGGCAGAGGTGAAAAAGTTG 
+                  -a TTTCTACTCCTTCAGTCCATGTCAGTGTCCTCGTGCTCCAGTCG -a CAACTTTTTCACCTCTGCCTAA 
+                  -o ${}
+                  ${fastq}
+  """
+}
\ No newline at end of file

src/nf_modules/danpos/main.nf

+// SPDX-FileCopyrightText: 2022 Laurent Modolo <laurent.modolo@ens-lyon.fr>
+//
+// SPDX-License-Identifier: AGPL-3.0-or-later
+
+version = "v2.2.2_cv3"
+container_url = "biocontainers/danpos:${version}"
+
+include {
+  bigwig2_to_wig2;
+  bigwig_to_wig;
+  wig_to_bedgraph;
+  wig2_to_bedgraph2
+} from "./../ucsc/main.nf"
+
+params.dpos = "--smooth_width 0 -n N "
+params.dpos_out = ""
+
+workflow dpos_bam_bg {
+  take:
+    fasta
+    fastq
+    bam
+
+  main:
+    dpos_bam(fastq, bam)
+    wig2_to_bedgraph2(fasta, dpos_bam.out.wig)
+
+  emit:
+    bg = wig2_to_bedgraph2.out.bg
+    wig = dpos_bam.out.wig
+    bed = dpos_bam.out.bed
+}
+
+process dpos_bam {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(bam_ip), path(bam_wce)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/${bam_ip.simpleName}*.wig"), path("${file_prefix}/${bam_wce.simpleName}*.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -b ${bam_wce} \
+  -o ${file_prefix} \
+  ${bam_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.bed
+"""
+}
+
+workflow dpos_bw {
+  take:
+    fasta
+    fastq
+    bw
+  main:
+    bigwig2_to_wig2(bw)
+    dpos_wig(fastq, bigwig2_to_wig2.out.wig)
+    wig_to_bedgraph(fasta, bigwig2_to_wig2.out.wig)
+
+  emit:
+  bg = wig_to_bedgraph.out.bg
+  wig = bigwig2_to_wig2.out.wig
+  bed = dpos_wig.out.bed
+}
+
+process dpos_wig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(wig_ip), path(wig_wce)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+    tuple val(file_id), path("${file_prefix}/${bam_ip.simpleName}*.wig"), path("${file_prefix}/${bam_wce.simpleName}*.wig"), emit: wig
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -b ${wig_wce} \
+  -o ${file_prefix} \
+  ${wig_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.positions.xls > ${file_prefix}/${wig_ip.simpleName}.positions.bed
+"""
+}
+
+workflow dpos_bw_no_b {
+  take:
+    fasta
+    fastq
+    bw
+  main:
+    bigwig_to_wig(bw)
+    dpos_wig_no_b(fastq, bigwig_to_wig.out.wig)
+    wig_to_bedgraph(fasta, bigwig_to_wig.out.wig)
+
+  emit:
+  bg = wig_to_bedgraph.out.bg
+  wig = bigwig_to_wig.out.wig
+  bed = dpos_wig_no_b.out.bed
+}
+
+process dpos_wig_no_b {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(wig_ip)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -o ${file_prefix} \
+  ${wig_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.positions.xls > ${file_prefix}/${wig_ip.simpleName}.positions.bed
+"""
+}
+
+workflow dwig_bwvsbw {
+  take:
+    fasta
+    fastq
+    bw_a
+    bw_b
+  main:
+    dpos_wigvswig(
+      fastq,
+      bigwig2_to_wig2(bw_a),
+      bigwig2_to_wig2(bw_b),
+    )
+    wig_to_bedgraph(fasta, dpos_wigvswig.out.wig)
+
+  emit:
+  bg = wig_to_bedgraph.out.bg
+  wig = dpeak_wig.out.wig
+  bed = dpeak_wig.out.bed
+}
+
+process dpos_wigvswig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpos_out != "") {
+    publishDir "results/${params.dpos_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id_a), path(wig_ip_a)
+    tuple val(file_id_b), path(wig_ip_b)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/${wig_ip_a.simpleName}*.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), emit: bed
+
+  script:
+
+  switch(file_id_a) {
+    case {it instanceof List}:
+      file_prefix = file_id_a[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id_a.values()[0]
+    break
+    default:
+      file_prefix = file_id_a
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpos -m ${m} \
+  ${params.dpos} \
+  -b ${wig_ip_a},${wig_ip_b} \
+  -o ${file_prefix} \
+  ${wig_ip_a}:${wig_ip_b}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.positions.xls > ${file_prefix}/${bam_ip.simpleName}.positions.bed
+"""
+}
+
+params.dpeak = "--smooth_width 0 -n N "
+params.dpeak_out = ""
+
+process dpeak_bam {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpeak_out != "") {
+    publishDir "results/${params.dpeak_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(bam_ip), path(bam_wce)
+
+  output:
+    tuple val(file_id), path("${file_prefix}/${bam_ip.simpleName}*.wig"), path("${file_prefix}/${bam_wce.simpleName}*.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), path("${file_prefix}/*.summit.bed"), emit: bed
+    tuple val(file_id), path("${file_prefix}/*.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpeak -m ${m} \
+  ${params.dpeak} \
+  -b ${bam_wce} \
+  -o ${file_prefix} \
+  ${bam_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.bed
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$4-1, \$4, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.summit.bed
+"""
+}
+
+workflow dpeak_bw {
+  take:
+    fasta
+    fastq
+    bw
+  main:
+    dpeak_wig(fastq, bigwig2_to_wig2(bw))
+    wig2_to_bedgraph2(fasta, dpeak_wig.out.wig)
+
+  emit:
+  bg = wig2_to_bedgraph2.out.bg
+  wig = dpeak_wig.out.wig
+  bed = dpeak_wig.out.bed
+}
+
+
+process dpeak_wig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpeak_out != "") {
+    publishDir "results/${params.dpeak_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id), path(wig_ip), path(wig_wce)
+
+  output:
+  tuple val(file_id), path("${file_prefix}/${wig_ip.simpleName}.bgsub.wig"), path("${file_prefix}/${wig_wce.simpleName}.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), path("${file_prefix}/*.summit.bed"), emit: bed
+
+  script:
+
+  switch(file_id) {
+    case {it instanceof List}:
+      file_prefix = file_id[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id.values()[0]
+    break
+    default:
+      file_prefix = file_id
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpeak -m ${m} \
+  ${params.dpeak} \
+  -b ${wig_wce} \
+  -o ${file_prefix} \
+  ${wig_ip}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${wig_ip.simpleName}.bgsub.positions.bed
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$4-1, \$4, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${wig_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${wig_ip.simpleName}.bgsub.positions.summit.bed
+"""
+}
+
+workflow dpeak_bwvsbw {
+  take:
+    fasta
+    fastq
+    bw_a
+    bw_b
+  main:
+    dpeak_wigvswig(
+      fastq,
+      bigwig2_to_wig2(bw_a),
+      bigwig2_to_wig2(bw_b),
+    )
+    wig2_to_bedgraph2(fasta, dpeak_wigvswig.out.wig)
+
+  emit:
+  bg = wig2_to_bedgraph2.out.bg
+  wig = dpeak_wig.out.wig
+  bed = dpeak_wig.out.bed
+}
+
+
+process dpeak_wigvswig {
+  container = "${container_url}"
+  label "big_mem_mono_cpus"
+  tag "$file_id"
+  if (params.dpeak_out != "") {
+    publishDir "results/${params.dpeak_out}", mode: 'copy', overwrite: true
+  }
+
+  input:
+    val fastq 
+    tuple val(file_id_a), path(wig_ip_a), path(wig_wce_a)
+    tuple val(file_id_b), path(wig_ip_b), path(wig_wce_b)
+
+  output:
+  tuple val(file_id), path("${file_prefix}/${wig_ip_a.simpleName}.bgsub.wig"), path("${file_prefix}/${wig_wce_a.simpleName}.wig"), emit: wig
+  tuple val(file_id), path("${file_prefix}/*.positions.bed"), path("${file_prefix}/*.summit.bed"), emit: bed
+
+  script:
+
+  switch(file_id_a) {
+    case {it instanceof List}:
+      file_prefix = file_id_a[0]
+    break
+    case {it instanceof Map}:
+      file_prefix = file_id_a.values()[0]
+    break
+    default:
+      file_prefix = file_id_a
+    break
+  }
+
+  m = 0
+  if (fastq[1].size() == 2){
+    m = 1
+  }
+"""
+danpos.py dpeak -m ${m} \
+  ${params.dpeak} \
+  -b ${wig_ip_a}:${wig_wce_a},${wig_ip_b}:${wig_wce_b} \
+  -o ${file_prefix} \
+  ${wig_ip_a}:${wig_ip_b}
+mv ${file_prefix}/pooled/* ${file_prefix}/
+rm -R ${file_prefix}/pooled
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$2-1, \$3, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.bed
+awk -v FS='\t' -v OFS='\t' 'FNR > 1 { print \$1, \$4-1, \$4, "Interval_"NR-1, \$6, "+" }' ${file_prefix}/${bam_ip.simpleName}.bgsub.peaks.xls > ${file_prefix}/${bam_ip.simpleName}.bgsub.positions.summit.bed
+"""
+}
\ No newline at end of file

src/nf_modules/deepTools/3.0.2/docker_init.sh

-#!/bin/sh
-docker build src/nf_modules/deepTools/3.0.2 -t 'deeptools:3.0.2'