From 4dc89d1a521774fca830c57fad3b90c48646febd Mon Sep 17 00:00:00 2001
From: xgrand <xavier.grand@ens-lyon.fr>
Date: Tue, 26 Sep 2023 09:58:30 +0200
Subject: [PATCH] Add pychopper instead porechop not functionnal
---
.../pychopper/2.5.0/Dockerfile | 21 +++++++++++++
.../pychopper/2.5.0/docker_init.sh | 10 ++++++
src/bolero.nf | 31 +++++++++++++++++--
src/nf_modules/pychopper/main.nf | 25 +++++++++++++++
4 files changed, 84 insertions(+), 3 deletions(-)
create mode 100644 src/.docker_modules/pychopper/2.5.0/Dockerfile
create mode 100755 src/.docker_modules/pychopper/2.5.0/docker_init.sh
create mode 100644 src/nf_modules/pychopper/main.nf
diff --git a/src/.docker_modules/pychopper/2.5.0/Dockerfile b/src/.docker_modules/pychopper/2.5.0/Dockerfile
new file mode 100644
index 0000000..16b78a0
--- /dev/null
+++ b/src/.docker_modules/pychopper/2.5.0/Dockerfile
@@ -0,0 +1,21 @@
+# SPDX-FileCopyrightText: 2023 Xavier Grand <xavier.grand@inserm.fr>
+#
+# SPDX-License-Identifier: AGPL-3.0-or-later
+
+FROM continuumio/miniconda3
+MAINTAINER Xavier Grand
+
+RUN apt-get update && apt-get install -y procps
+
+ENV PYCHOPPER_VERSION="2.5.0"
+RUN conda init \
+&& conda config --add channels r \
+&& conda config --add channels defaults \
+&& conda config --add channels conda-forge \
+&& conda config --add channels bioconda \
+&& conda create -y -n pychopper
+SHELL ["conda", "run", "-n", "pychopper", "/bin/bash", "-c"]
+RUN conda install -c nanoporetech -c conda-forge -c bioconda "nanoporetech::pychopper" \
+&& echo "conda activate pychopper" >> /root/.bashrc
+
+ENV PATH /usr/local/envs/pychopper/bin:/usr/local/condabin:$PATH
\ No newline at end of file
diff --git a/src/.docker_modules/pychopper/2.5.0/docker_init.sh b/src/.docker_modules/pychopper/2.5.0/docker_init.sh
new file mode 100755
index 0000000..b4adae1
--- /dev/null
+++ b/src/.docker_modules/pychopper/2.5.0/docker_init.sh
@@ -0,0 +1,10 @@
+#!/bin/sh
+# docker pull lbmc/pychopper:2.5.0
+# docker build src/.docker_modules/pychopper/2.5.0 -t 'lbmc/pychopper:2.5.0'
+# docker push lbmc/pychopper:2.5.0
+# docker buildx build --platform linux/amd64,linux/arm64 -t "lbmc/pychopper:2.5.0" --push src/.docker_modules/pychopper/2.5.0
+
+# docker pull xgrand/pychopper:2.5.0
+docker build src/.docker_modules/pychopper/2.5.0 -t 'xgrand/pychopper:2.5.0'
+docker push xgrand/pychopper:2.5.0
+# docker buildx build --platform linux/amd64,linux/arm64 -t "xgrand/pychopper:2.5.0" --push src/.docker_modules/pychopper/2.5.0
\ No newline at end of file
diff --git a/src/bolero.nf b/src/bolero.nf
index 2bb2162..15a06d0 100755
--- a/src/bolero.nf
+++ b/src/bolero.nf
@@ -84,9 +84,9 @@ params.skipBC = true
params.gpu_mode = false
params.adapt = "CGACTGGAGCACGAGGACACTGA" // "CGACTGGAGCACGAGGACACTGACATGGACTGAAGGAGTAGAAA" //
params.gsp = "TTAGGCAGAGGTGAAAAAGTTG"
-params.transcriptome = "./data/202201_Full-length_HBV_GTFv3/20220112_preCore_FL_HBV_XGR_transcripts.fasta"
-params.genome = "./data/202201_Full-length_HBV_GTFv3/preCore_XGR.fasta"
-params.gtf = "./data/202201_Full-length_HBV_GTFv3/20220112_GTF_preCore_FL_HBV_XGR.gtf"
+// params.transcriptome = "./data/202201_Full-length_HBV_GTFv3/20220112_preCore_FL_HBV_XGR_transcripts.fasta"
+params.genome = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_HBV_FL_preCore_reference.fasta"
+params.gtf = "/home/xavier/Data/Genome/202201_Full-length_HBV_GTFv3/20230516_GTF_preCore_FL_HBV_XGR.gtf"
params.flowcell = "FLO-MIN106"
params.kit = "SQK-PBK004"
@@ -188,7 +188,9 @@ include { start_position_individuals } from "./nf_modules/start_positions/main.n
include { jwr_checker } from "./nf_modules/nanosplicer/main.nf"
include { junctions_nanosplicer } from "./nf_modules/junction_nanosplicer/main.nf"
include { rna_count } from "./nf_modules/rna_count/main.nf"
+
include { porechop } from "./nf_modules/porechop/main.nf"
+include { trimmming_pychopper } from "./nf_modules/pychopper/main.nf"
/*
****************************************************************
@@ -250,9 +252,13 @@ workflow {
//Trimming with porechop
porechop(seqkit_grep.out.filtered_fastq)
+
+ //Trimming with pychopper
+ //trimmming_pychopper(seqkit_grep.out.filtered_fastq)
//Cut of the 5'RACE sequence
cut_5pRACE(porechop.out.porechoped_fastq, params.adapt)
+ //cut_5pRACE(trimmming_pychopper.out.pychoped_fastq, params.adapt)
//cut_5pRACE(seqkit_grep.out.filtered_fastq, params.adapt)
//########################## MAPPING ##########################
@@ -304,3 +310,22 @@ workflow {
rna_count(files_for_rna_count)
}
+
+// End message:
+
+workflow.onComplete {
+
+ println ( workflow.success ? """
+ DUPFinder tools execution summary
+ ---------------------------
+ Completed at : ${workflow.complete}
+ Duration : ${workflow.duration}
+ Success : ${workflow.success}
+ workDir : ${workflow.workDir}
+ exit status : ${workflow.exitStatus}
+ """ : """
+ Failed: ${workflow.errorReport}
+ exit status : ${workflow.exitStatus}
+ """
+ )
+}
diff --git a/src/nf_modules/pychopper/main.nf b/src/nf_modules/pychopper/main.nf
new file mode 100644
index 0000000..1102b61
--- /dev/null
+++ b/src/nf_modules/pychopper/main.nf
@@ -0,0 +1,25 @@
+version = "2.5.0"
+container_url = "xgrand/pychopper:${version}"
+
+params.pychopper_out =""
+process trimmming_pychopper {
+ container = "${container_url}"
+ label "big_mem_multi_cpus"
+ tag "${barcode}"
+ if (params.pychopper_out != "") {
+ publishDir "results/${params.pychopper_out}", mode: 'copy'
+ }
+
+ input:
+ tuple val(barcode), path(fastq)
+
+ output:
+ tuple val(barcode), path("${barcode}/${barcode}_merged_pychoped.fastq.gz"), emit: pychoped_fastq
+
+ script:
+"""
+mkdir ${barcode}
+cd ${barcode}/
+pychopper -k ${params.kit} -r ${barcode}_pychopper_report.pdf -S ${barcode}_statistics.tsv -t ${task.cpus} ../${fastq} ${barcode}_merged_pychoped.fastq.gz
+"""
+}
\ No newline at end of file
--
GitLab