Verified Commit 44ae5e28 authored by Gael Yvert's avatar Gael Yvert
Browse files

bugfix: remove reference to deprecated column in seeder for dna-features

parent 407a5166
......@@ -17,7 +17,6 @@ class DnaFeaturesTableSeeder extends Seeder
DB::table('dna_features')->insert([
'sequence' => 'tcatgtaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttatttttttatagttatgttagtattaagaacgttatttatatttcaaatttttcttttttttctgtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaaggttttgggacgctcgaaggctttaatttgcggccg',
'name' => 'CYC1-terminator',
'category' => 'Terminators',
'comments' => '',
'created_at' => date('Y-m-d H:i:s'),
'updated_at' => date('Y-m-d H:i:s'),
......@@ -26,7 +25,6 @@ class DnaFeaturesTableSeeder extends Seeder
DB::table('dna_features')->insert([
'sequence' => 'ATAACTTCGTATAATGTATGCTATACGAAGTTAT',
'name' => 'LoxP',
'category' => 'Miscellaneous features',
'comments' => '',
'created_at' => date('Y-m-d H:i:s'),
'updated_at' => date('Y-m-d H:i:s'),
......
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment