diff --git a/src/RibosomeProfiling.config b/src/RibosomeProfiling.config
new file mode 100644
index 0000000000000000000000000000000000000000..6837f9cc1217343f7067a3a7a0eff8019c7391c0
--- /dev/null
+++ b/src/RibosomeProfiling.config
@@ -0,0 +1,112 @@
+profiles {
+ sge {
+ process{
+ withName: trimming {
+ beforeScript = "source $baseDir/.conda_psmn.sh"
+ conda = "$baseDir/.conda_envs/cutadapt_2.1"
+ executor = "sge"
+ clusterOptions = "-cwd -V"
+ cpus = 1
+ memory = "20GB"
+ time = "12h"
+ queue = 'monointeldeb128,monointeldeb48,h48-E5-2670deb128,h6-E5-2667v4deb128'
+ }
+ withName: rRNA_removal {
+ beforeScript = "source $baseDir/.conda_psmn.sh"
+ conda = "$baseDir/.conda_envs/bowtie2_2.3.4.1"
+ executor = "sge"
+ clusterOptions = "-cwd -V"
+ cpus = 16
+ memory = "30GB"
+ time = "24h"
+ queue = 'E5-2670deb128A,E5-2670deb128B,E5-2670deb128C,E5-2670deb128D,E5-2670deb128E,E5-2670deb128F'
+ penv = 'openmp16'
+ }
+ withName: hisat2_human {
+ beforeScript = "source /usr/share/lmod/lmod/init/bash; module use ~/privatemodules"
+ module = "hisat2/2.1.0:samtools/1.7"
+ executor = "sge"
+ clusterOptions = "-cwd -V"
+ memory = "20GB"
+ cpus = 16
+ time = "12h"
+ queue = 'E5-2670deb128A,E5-2670deb128B,E5-2670deb128C,E5-2670deb128D,E5-2670deb128E,E5-2670deb128F'
+ penv = 'openmp16'
+ }
+ withName: sort_bam {
+ beforeScript = "source $baseDir/.conda_psmn.sh"
+ conda = "$baseDir/.conda_envs/samtools_1.7"
+ executor = "sge"
+ clusterOptions = "-cwd -V"
+ cpus = 1
+ memory = "20GB"
+ time = "12h"
+ queue = 'monointeldeb128,monointeldeb48,h48-E5-2670deb128,h6-E5-2667v4deb128'
+ }
+ withName: index_bam {
+ beforeScript = "source $baseDir/.conda_psmn.sh"
+ conda = "$baseDir/.conda_envs/samtools_1.7"
+ executor = "sge"
+ clusterOptions = "-cwd -V"
+ cpus = 1
+ memory = "20GB"
+ time = "12h"
+ queue = 'monointeldeb128,monointeldeb48,h48-E5-2670deb128,h6-E5-2667v4deb128'
+ }
+ withName: dedup {
+ beforeScript = "source /usr/share/lmod/lmod/init/bash; module use ~/privatemodules"
+ module = "umi_tools/1.0.0"
+ executor = "sge"
+ clusterOptions = "-cwd -V"
+ cpus = 1
+ memory = "20GB"
+ time = "12h"
+ queue = 'monointeldeb128,monointeldeb48,h48-E5-2670deb128,h6-E5-2667v4deb128'
+ }
+ withName: counting {
+ beforeScript = "source /usr/share/lmod/lmod/init/bash; module use ~/privatemodules"
+ module = "htseq/0.11.2"
+ executor = "sge"
+ clusterOptions = "-cwd -V"
+ cpus = 1
+ memory = "20GB"
+ time = "12h"
+ queue = 'monointeldeb128,monointeldeb48,h48-E5-2670deb128,h6-E5-2667v4deb128'
+ }
+ }
+ }
+ docker {
+ docker.temp = 'auto'
+ docker.enabled = true
+ process {
+ withName: adaptor_removal {
+ container = "lbmc/cutadapt:2.1"
+ cpus = 1
+ }
+ withName: rRNA_removal {
+ container = "lbmc/bowtie2:2.3.4.1"
+ cpus = 4
+ }
+ withName: hisat2_human {
+ cpus = 4
+ container = "lbmc/hisat2:2.1.0"
+ }
+ withName: sort_bam {
+ container = "lbmc/samtools:1.7"
+ cpus = 1
+ }
+ withName: index_bam {
+ container = "lbmc/samtools:1.7"
+ cpus = 1
+ }
+ withName: dedup {
+ container = "lbmc/umi_tools:1.0.0"
+ cpus = 1
+ }
+ withName: counting {
+ container = "lbmc/htseq:0.11.2"
+ cpus = 1
+ }
+ }
+ }
+}
diff --git a/src/RibosomeProfiling.nf b/src/RibosomeProfiling.nf
new file mode 100644
index 0000000000000000000000000000000000000000..15e02098a462d9a5c7126218b3364106ee53da4d
--- /dev/null
+++ b/src/RibosomeProfiling.nf
@@ -0,0 +1,211 @@
+/*
+* RibosomeProfiling Analysis pipeline
+*/
+
+/* Trimming */
+params.output = "results"
+params.fastq_raw = "${params.output}/00_demultiplexing/*.fastq.gz"
+
+Channel
+ .fromPath( params.fastq_raw )
+ .ifEmpty { error "Cannot find any files matching: ${params.fastq_raw}" }
+ .map { it -> [(it.baseName =~ /([^\.]*)/)[0][1], it]}
+ .set { fastq_raw_flow }
+
+
+process trimming {
+ tag "$file_id"
+ publishDir "${params.output}/01_trimming/", mode: 'copy'
+
+ input:
+ set file_id, file(fastq_raw) from fastq_raw_flow
+
+ output:
+ set file_id, "*_cut.fastq.gz" into fastq_trim_filt
+ file "*.txt" into log_trim
+
+ script:
+ """
+ cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -m 20\
+ -o ${file_id}_cut.fastq.gz \
+ ${fastq_raw} > ${file_id}_report.txt
+ """
+}
+
+/* rRNA and tRNA filtering */
+
+params.indexrRNA = "results/human_rRNA_tRNA/*.bt2"
+log.info "index files rRNA : ${params.indexrRNA}"
+
+Channel
+ .fromPath( params.indexrRNA )
+ .ifEmpty { error "Cannot find any index files matching: ${params.indexrRNA}" }
+ .set { rRNA_index_files }
+
+process rRNA_removal {
+ tag "$file_id"
+ publishDir "${params.output}/02_rRNA_depletion/", mode: 'copy'
+
+ input:
+ set file_id, file(reads) from fastq_trim_filt
+ file index from rRNA_index_files.toList()
+
+ output:
+ set file_id, "*.fastq.gz" into rRNA_removed_reads
+ file "*.txt" into bowtie_report
+
+ script:
+"""
+zcat ${reads} | bowtie2 --sensitive -p ${task.cpus} -x human_rRNA_tRNA \
+-U - --un-gz ${file_id}_mRNA.fastq.gz 2> \
+${file_id}_bowtie2_report.txt > /dev/null
+
+if grep -q "Error " ${file_id}_bowtie2_report.txt; then
+ exit 1
+fi
+"""
+}
+
+/* mapping against human genome with hisat2 */
+
+params.index_hg38 = "/media/adminmanu/Stockage/HISAT2_index_hg38_tran/*.ht2"
+
+log.info "index : ${params.index_hg38}"
+
+
+Channel
+ .fromPath ( params.index_hg38 )
+ .ifEmpty { error "Cannot find any hg38 index files matching: ${params.index_hg38}" }
+ .set { index_file_hg38 }
+
+process hisat2_human {
+ tag "$file_id"
+
+
+ input:
+ set file_id, file(fastq_filtred) from rRNA_removed_reads
+ file index from index_file_hg38.toList()
+
+ output:
+ set file_id, "*.fastq.gz" into reads_non_aligned_hg38
+ set file_id, "*.bam" into reads_aligned_hg38
+ file "*.txt" into hisat_report
+
+ script:
+"""
+hisat2 -x genome_tran -p ${task.cpus} \
+-U ${fastq_filtred} --un-gz ${file_id}_notaligned_hg38.fastq.gz \
+--end-to-end --rna-strandness 'F' \
+2> ${file_id}_hisat2_hg38.txt | samtools view -bS -F 4 -o ${file_id}.bam
+
+"""
+}
+
+/* sorting */
+
+process index_bam {
+ tag "$file_id"
+ publishDir "${params.output}/03_hisat2_hg38/", mode: 'copy'
+
+ input:
+ set file_id, file(bam) from reads_aligned_hg38
+
+ output:
+ set file_id, "*_sorted.{bam,bam.bai}" into sorted_bam_files
+
+ script:
+"""
+samtools sort -@ ${task.cpus} -O BAM -o ${file_id}_sorted.bam ${bam}
+samtools index ${file_id}_sorted.bam
+"""
+}
+
+sorted_bam_files.into{for_dedup;for_htseq}
+
+/* deduplicating reads */
+
+params.dedup_options = ""
+
+process dedup {
+ tag "$file_id"
+
+ input:
+ set file_id, file(bam) from for_dedup
+
+ output:
+ set file_id, "*dedup.bam" into dedup_bam
+ file "*.txt" into dedup_report
+
+ script:
+"""
+umi_tools dedup -I ${bam[0]} \
+ ${params.dedup_options} \
+ -S ${file_id}_dedup.bam > report.txt
+"""
+}
+
+process sort_bam {
+ tag "$file_id"
+ publishDir "${params.output}/03_hisat2_hg38_dedup/", mode: 'copy'
+
+ input:
+ set file_id, file(bam) from dedup_bam
+ file dedup from dedup_report
+
+ output:
+ set file_id, "*_sorted.{bam,bam.bai}" into sorted_bam_files_2
+ file "*.txt" into report_dedup
+
+ script:
+"""
+samtools sort -@ ${task.cpus} -O BAM -o ${file_id}_sorted.bam ${bam}
+samtools index ${file_id}_sorted.bam
+cat ${dedup} > ${file_id}_dedup_report.txt
+"""
+}
+
+/* HTseq */
+
+params.gtf = "$baseDir/data/annotation/*.gtf"
+log.info "gtf files : ${params.gtf}"
+
+Channel
+ .fromPath( params.gtf )
+ .ifEmpty { error "Cannot find any gtf file matching: ${params.gtf}" }
+ .set { gtf_file }
+
+process counting {
+ tag "$file_id"
+ publishDir "${params.output}/04_HTseq/", mode: 'copy'
+
+ input:
+ set file_id, file(bam) from for_htseq
+ file gtf from gtf_file.toList()
+
+ output:
+ file "*.count" into count_files
+
+ script:
+"""
+htseq-count ${bam[0]} ${gtf} \
+ --mode=intersection-nonempty \
+ -a 10 \
+ -s yes \
+ -t CDS \
+ -i gene_id \
+ -r pos \
+ -f bam \
+> ${file_id}_CDS.count
+
+htseq-count ${bam[0]} ${gtf} \
+ --mode=intersection-nonempty \
+ -a 10 \
+ -s yes \
+ -t exon \
+ -i gene_id \
+ -r pos \
+ -f bam \
+> ${file_id}_exon.count
+
+"""
+}